\
| Variant ID: vg0711195681 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11195681 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )
TTAAGGTTTCGAACTTCTCTTCAAGAGAGAGGTAAGCTTTGTCCAAGCCATCCACTCTCTCTTGAAGTTGAGCGTTCGCCACCTCAAGATTAGCATGAGA[T/C]
TCTTTGGTTTGCTTGTAAAGCCGTACCAAAGCCTCATTTTTCTCTCTCTCCTTAGCAAGTTCACTCTTGAGTTCATGAGACCGCTCTTTCTCATGAATGA
TCATTCATGAGAAAGAGCGGTCTCATGAACTCAAGAGTGAACTTGCTAAGGAGAGAGAGAAAAATGAGGCTTTGGTACGGCTTTACAAGCAAACCAAAGA[A/G]
TCTCATGCTAATCTTGAGGTGGCGAACGCTCAACTTCAAGAGAGAGTGGATGGCTTGGACAAAGCTTACCTCTCTCTTGAAGAGAAGTTCGAAACCTTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.50% | 20.10% | 9.48% | 40.92% | NA |
| All Indica | 2759 | 5.60% | 33.30% | 14.46% | 46.65% | NA |
| All Japonica | 1512 | 75.90% | 0.90% | 1.46% | 21.76% | NA |
| Aus | 269 | 18.60% | 2.60% | 3.72% | 75.09% | NA |
| Indica I | 595 | 7.40% | 27.10% | 24.87% | 40.67% | NA |
| Indica II | 465 | 6.50% | 34.00% | 11.40% | 48.17% | NA |
| Indica III | 913 | 3.60% | 36.90% | 6.68% | 52.79% | NA |
| Indica Intermediate | 786 | 6.10% | 33.30% | 17.43% | 43.13% | NA |
| Temperate Japonica | 767 | 67.90% | 0.90% | 2.35% | 28.81% | NA |
| Tropical Japonica | 504 | 86.10% | 0.40% | 0.20% | 13.29% | NA |
| Japonica Intermediate | 241 | 79.70% | 2.10% | 1.24% | 17.01% | NA |
| VI/Aromatic | 96 | 2.10% | 0.00% | 6.25% | 91.67% | NA |
| Intermediate | 90 | 42.20% | 14.40% | 12.22% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711195681 | T -> DEL | LOC_Os07g18890.1 | N | frameshift_variant | Average:8.091; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg0711195681 | T -> C | LOC_Os07g18890.1 | synonymous_variant ; p.Glu464Glu; LOW | synonymous_codon | Average:8.091; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711195681 | 7.54E-06 | NA | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | 1.57E-06 | 9.97E-06 | mr1255_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | NA | 5.24E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | NA | 4.87E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | 4.89E-06 | NA | mr1679_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | 2.20E-06 | NA | mr1691_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | NA | 3.43E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | NA | 4.59E-15 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | NA | 7.28E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | NA | 4.53E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | NA | 8.15E-15 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711195681 | NA | 3.63E-12 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |