\
| Variant ID: vg0711119293 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11119293 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 322. )
GACACAAAGTCCAGGATACAAATTAAATATACCTGGTCAAATCTGTGGTCAAGGAAATTAATCCATAGACAAATCAGCTATTACATGCACAAAGTGGTCT[C/T]
CAAACTAATCCATGCATGTGCTACCGACGATTACATGTCTACACGGCTGCATGACACGGCTGCATGCTACGGTTCATCCATTGACAGGCCTTGAATCAAA
TTTGATTCAAGGCCTGTCAATGGATGAACCGTAGCATGCAGCCGTGTCATGCAGCCGTGTAGACATGTAATCGTCGGTAGCACATGCATGGATTAGTTTG[G/A]
AGACCACTTTGTGCATGTAATAGCTGATTTGTCTATGGATTAATTTCCTTGACCACAGATTTGACCAGGTATATTTAATTTGTATCCTGGACTTTGTGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 5.50% | 0.85% | 6.22% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.00% | 0.04% | NA |
| All Japonica | 1512 | 61.40% | 16.70% | 2.51% | 19.31% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 75.10% | 2.90% | 1.83% | 20.21% | NA |
| Tropical Japonica | 504 | 27.80% | 43.70% | 3.57% | 25.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 4.60% | 2.49% | 4.56% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 8.90% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711119293 | C -> DEL | N | N | silent_mutation | Average:38.373; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| vg0711119293 | C -> T | LOC_Os07g18790.1 | upstream_gene_variant ; 363.0bp to feature; MODIFIER | silent_mutation | Average:38.373; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| vg0711119293 | C -> T | LOC_Os07g18780-LOC_Os07g18790 | intergenic_region ; MODIFIER | silent_mutation | Average:38.373; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711119293 | 5.23E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 1.62E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 1.93E-09 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | 7.09E-06 | 7.08E-06 | mr1335_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | 3.12E-06 | 3.80E-11 | mr1363_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 7.55E-09 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 1.81E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 8.44E-07 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 4.91E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 1.48E-06 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 1.06E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 2.09E-08 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 1.24E-07 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 5.04E-13 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711119293 | NA | 1.79E-09 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |