\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711095758:

Variant ID: vg0711095758 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11095758
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATCAACAGGTCGCCTTCTATCCCACTTAATAAGAAAACTCCCATTGAGGTATGGTCTGGTATGCCTGCTGATTATTCACAATTGAGAGTTTTTGGATG[T/C]
ACTGCTTATGCTCACGTTGATAATGGAAAATTAGAGCCTAGAGCTATTAAGTGTCTGTTTCTTGGTTATGGTTCAGGAGTAAAAGGATATAAATTATGGA

Reverse complement sequence

TCCATAATTTATATCCTTTTACTCCTGAACCATAACCAAGAAACAGACACTTAATAGCTCTAGGCTCTAATTTTCCATTATCAACGTGAGCATAAGCAGT[A/G]
CATCCAAAAACTCTCAATTGTGAATAATCAGCAGGCATACCAGACCATACCTCAATGGGAGTTTTCTTATTAAGTGGGATAGAAGGCGACCTGTTGATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 28.10% 2.43% 4.72% NA
All Indica  2759 96.20% 2.30% 1.12% 0.36% NA
All Japonica  1512 6.30% 76.90% 3.31% 13.43% NA
Aus  269 88.50% 5.20% 5.20% 1.12% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 98.70% 0.40% 0.88% 0.00% NA
Indica Intermediate  786 91.00% 5.00% 2.80% 1.27% NA
Temperate Japonica  767 2.10% 68.30% 5.22% 24.38% NA
Tropical Japonica  504 13.50% 86.10% 0.20% 0.20% NA
Japonica Intermediate  241 5.00% 85.10% 3.73% 6.22% NA
VI/Aromatic  96 24.00% 52.10% 16.67% 7.29% NA
Intermediate  90 55.60% 40.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711095758 T -> DEL LOC_Os07g18760.1 N frameshift_variant Average:12.722; most accessible tissue: Callus, score: 16.877 N N N N
vg0711095758 T -> C LOC_Os07g18760.1 synonymous_variant ; p.Cys583Cys; LOW synonymous_codon Average:12.722; most accessible tissue: Callus, score: 16.877 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711095758 3.52E-06 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 6.93E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 1.04E-15 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 5.41E-07 4.12E-07 mr1517 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 9.61E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 7.66E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 7.94E-07 2.92E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 2.22E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 2.23E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 1.04E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 8.08E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 9.80E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 7.75E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 2.04E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 1.68E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 7.15E-13 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 9.76E-13 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 2.14E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 1.17E-10 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 9.87E-17 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 9.91E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 2.16E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 1.11E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 1.38E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 3.04E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758 NA 5.06E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251