Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711095758:

Variant ID: vg0711095758 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11095758
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGATCAACAGGTCGCCTTCTATCCCACTTAATAAGAAAACTCCCATTGAGGTATGGTCTGGTATGCCTGCTGATTATTCACAATTGAGAGTTTTTGGATG[T/C]
ACTGCTTATGCTCACGTTGATAATGGAAAATTAGAGCCTAGAGCTATTAAGTGTCTGTTTCTTGGTTATGGTTCAGGAGTAAAAGGATATAAATTATGGA

Reverse complement sequence

TCCATAATTTATATCCTTTTACTCCTGAACCATAACCAAGAAACAGACACTTAATAGCTCTAGGCTCTAATTTTCCATTATCAACGTGAGCATAAGCAGT[A/G]
CATCCAAAAACTCTCAATTGTGAATAATCAGCAGGCATACCAGACCATACCTCAATGGGAGTTTTCTTATTAAGTGGGATAGAAGGCGACCTGTTGATCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	28.10%	2.43%	4.72%	NA
All Indica	2759	96.20%	2.30%	1.12%	0.36%	NA
All Japonica	1512	6.30%	76.90%	3.31%	13.43%	NA
Aus	269	88.50%	5.20%	5.20%	1.12%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	98.70%	0.40%	0.88%	0.00%	NA
Indica Intermediate	786	91.00%	5.00%	2.80%	1.27%	NA
Temperate Japonica	767	2.10%	68.30%	5.22%	24.38%	NA
Tropical Japonica	504	13.50%	86.10%	0.20%	0.20%	NA
Japonica Intermediate	241	5.00%	85.10%	3.73%	6.22%	NA
VI/Aromatic	96	24.00%	52.10%	16.67%	7.29%	NA
Intermediate	90	55.60%	40.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711095758	T -> DEL	LOC_Os07g18760.1	N	frameshift_variant	Average:12.722; most accessible tissue: Callus, score: 16.877	N	N	N	N
vg0711095758	T -> C	LOC_Os07g18760.1	synonymous_variant ; p.Cys583Cys; LOW	synonymous_codon	Average:12.722; most accessible tissue: Callus, score: 16.877	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711095758	3.52E-06	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	6.93E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	1.04E-15	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	5.41E-07	4.12E-07	mr1517	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	9.61E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	7.66E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	7.94E-07	2.92E-07	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	2.22E-25	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	2.23E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	1.04E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	8.08E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	9.80E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	7.75E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	2.04E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	1.68E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	7.15E-13	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	9.76E-13	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	2.14E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	1.17E-10	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	9.87E-17	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	9.91E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	2.16E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	1.11E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	1.38E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	3.04E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095758	NA	5.06E-15	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251