\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711095110:

Variant ID: vg0711095110 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11095110
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, G: 0.21, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


CATTACATGGTTCTGTTACCGCTGCTGCTGTTTCTAAAGATGAACCTAGTAAGACTAACCTGTGGCATATGCGTCTTGGACATATGAGTGAACGTGGTAT[A/G]
GCAGAATTGATGAAGAGGAACCTGTTGGATGGCTGCACTCAGGGTAACATGAAGTTCTGTGAGCACTGTGTTTTTGGTAAGCACAAGAGGGTAAAATTCA

Reverse complement sequence

TGAATTTTACCCTCTTGTGCTTACCAAAAACACAGTGCTCACAGAACTTCATGTTACCCTGAGTGCAGCCATCCAACAGGTTCCTCTTCATCAATTCTGC[T/C]
ATACCACGTTCACTCATATGTCCAAGACGCATATGCCACAGGTTAGTCTTACTAGGTTCATCTTTAGAAACAGCAGCAGCGGTAACAGAACCATGTAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 25.50% 1.35% 7.83% NA
All Indica  2759 96.60% 1.40% 0.47% 1.56% NA
All Japonica  1512 6.20% 74.70% 1.26% 17.79% NA
Aus  269 94.80% 0.40% 2.23% 2.60% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 91.00% 2.20% 1.53% 5.34% NA
Temperate Japonica  767 1.80% 66.10% 1.17% 30.90% NA
Tropical Japonica  504 13.50% 85.90% 0.20% 0.40% NA
Japonica Intermediate  241 5.00% 78.80% 3.73% 12.45% NA
VI/Aromatic  96 27.10% 0.00% 21.88% 51.04% NA
Intermediate  90 54.40% 37.80% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711095110 A -> DEL LOC_Os07g18760.1 N frameshift_variant Average:20.503; most accessible tissue: Minghui63 flag leaf, score: 30.104 N N N N
vg0711095110 A -> G LOC_Os07g18760.1 missense_variant ; p.Ile367Met; MODERATE nonsynonymous_codon ; I367M Average:20.503; most accessible tissue: Minghui63 flag leaf, score: 30.104 benign 0.026 TOLERATED 0.74

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711095110 NA 9.31E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 2.76E-06 NA mr1065 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 3.09E-90 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 6.25E-80 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 8.95E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 3.51E-06 3.47E-90 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 7.78E-07 3.80E-95 mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 4.51E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 9.83E-27 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 7.97E-07 1.90E-89 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 3.14E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 4.62E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 2.27E-07 NA mr1517 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 1.48E-06 1.78E-06 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 8.35E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 1.42E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 9.72E-26 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 1.56E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 1.28E-11 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 5.76E-06 6.81E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 7.43E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 1.07E-19 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 2.83E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 3.89E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 4.27E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 1.60E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711095110 NA 9.95E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251