Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711094601:

Variant ID: vg0711094601 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11094601
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGCAAAAAGAAAAATCACTTCATTGAAGAATGTTGGAAGGTGCAGGATAAGGAGAAAAGGAAATCTGATGGTAAGGCCTCTGTTGTTACTAGTGCTGAA[T/A]
ACTCTGATTCAGGAGATTGTCTTGTCGTTTTTGCTGGTTGTGTTGCTAGTCATGATGAATGGATTCTTGATACTGCATATTCGTTTCATATCTGCATTAA

Reverse complement sequence

TTAATGCAGATATGAAACGAATATGCAGTATCAAGAATCCATTCATCATGACTAGCAACACAACCAGCAAAAACGACAAGACAATCTCCTGAATCAGAGT[A/T]
TTCAGCACTAGTAACAACAGAGGCCTTACCATCAGATTTCCTTTTCTCCTTATCCTGCACCTTCCAACATTCTTCAATGAAGTGATTTTTCTTTTTGCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	25.80%	12.44%	8.61%	NA
All Indica	2759	81.80%	1.90%	14.68%	1.56%	NA
All Japonica	1512	1.70%	74.50%	4.89%	18.85%	NA
Aus	269	62.80%	0.70%	32.34%	4.09%	NA
Indica I	595	90.80%	1.50%	7.56%	0.17%	NA
Indica II	465	82.60%	3.20%	14.19%	0.00%	NA
Indica III	913	80.00%	1.10%	18.73%	0.22%	NA
Indica Intermediate	786	76.80%	2.40%	15.65%	5.09%	NA
Temperate Japonica	767	1.80%	65.40%	0.91%	31.81%	NA
Tropical Japonica	504	0.80%	86.10%	12.30%	0.79%	NA
Japonica Intermediate	241	3.30%	79.30%	2.07%	15.35%	NA
VI/Aromatic	96	17.70%	2.10%	12.50%	67.71%	NA
Intermediate	90	44.40%	41.10%	11.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711094601	T -> DEL	LOC_Os07g18760.1	N	frameshift_variant	Average:22.449; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0711094601	T -> A	LOC_Os07g18760.1	missense_variant ; p.Tyr198Asn; MODERATE	nonsynonymous_codon ; Y198N	Average:22.449; most accessible tissue: Zhenshan97 panicle, score: 32.308	probably damaging	-2.434	TOLERATED	0.65

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711094601	NA	1.69E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	4.64E-91	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	7.17E-80	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	1.19E-75	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	1.47E-06	2.76E-92	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	4.37E-06	2.20E-95	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	1.06E-26	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	1.64E-07	3.58E-92	mr1395	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	3.25E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	8.48E-07	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	2.72E-06	1.20E-06	mr1517	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	7.98E-06	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	5.41E-06	3.65E-92	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	2.17E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	1.34E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	1.41E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	1.33E-09	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	3.95E-06	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	1.69E-25	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	2.08E-19	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	7.90E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	4.97E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	7.00E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	1.41E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	3.06E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711094601	NA	4.76E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251