Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711050248:

Variant ID: vg0711050248 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11050248
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGTACACAATCCAATGACAGATAGTAATGCTGAATAAAAATCCCAAGTCACTTGCCCTTAGTTGCTGGTCTACTCGTGTCCTAGATAGTAGTGGTAACA[G/A]
TTATGGCTCAAGAAAAATGACACTAGTAAGCAGCAAAGAAGGACATGCAGGAAAGCTTCGGCGAGTTTCAGCAAAAACTACAAAATCGAACTGGCAGATA

Reverse complement sequence

TATCTGCCAGTTCGATTTTGTAGTTTTTGCTGAAACTCGCCGAAGCTTTCCTGCATGTCCTTCTTTGCTGCTTACTAGTGTCATTTTTCTTGAGCCATAA[C/T]
TGTTACCACTACTATCTAGGACACGAGTAGACCAGCAACTAAGGGCAAGTGACTTGGGATTTTTATTCAGCATTACTATCTGTCATTGGATTGTGTACCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	25.20%	0.34%	9.08%	NA
All Indica	2759	96.40%	1.30%	0.25%	2.07%	NA
All Japonica	1512	6.30%	74.50%	0.20%	18.98%	NA
Aus	269	95.50%	0.00%	0.37%	4.09%	NA
Indica I	595	98.80%	0.30%	0.67%	0.17%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	99.50%	0.30%	0.11%	0.11%	NA
Indica Intermediate	786	91.00%	1.80%	0.25%	7.00%	NA
Temperate Japonica	767	1.80%	65.80%	0.39%	31.94%	NA
Tropical Japonica	504	13.70%	85.70%	0.00%	0.60%	NA
Japonica Intermediate	241	5.00%	78.80%	0.00%	16.18%	NA
VI/Aromatic	96	24.00%	0.00%	3.12%	72.92%	NA
Intermediate	90	58.90%	34.40%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711050248	G -> DEL	N	N	silent_mutation	Average:21.768; most accessible tissue: Minghui63 flag leaf, score: 28.142	N	N	N	N
vg0711050248	G -> A	LOC_Os07g18690.1	upstream_gene_variant ; 2446.0bp to feature; MODIFIER	silent_mutation	Average:21.768; most accessible tissue: Minghui63 flag leaf, score: 28.142	N	N	N	N
vg0711050248	G -> A	LOC_Os07g18700.1	downstream_gene_variant ; 689.0bp to feature; MODIFIER	silent_mutation	Average:21.768; most accessible tissue: Minghui63 flag leaf, score: 28.142	N	N	N	N
vg0711050248	G -> A	LOC_Os07g18690-LOC_Os07g18700	intergenic_region ; MODIFIER	silent_mutation	Average:21.768; most accessible tissue: Minghui63 flag leaf, score: 28.142	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711050248	NA	5.02E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	5.80E-06	4.90E-95	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	5.58E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	7.70E-81	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	7.56E-06	1.00E-78	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	5.92E-06	4.39E-07	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.59E-92	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	7.48E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	8.31E-26	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	3.70E-96	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	7.39E-90	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	7.54E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	9.53E-06	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	2.00E-19	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	4.50E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.26E-76	mr1613	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	3.57E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.79E-92	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.16E-65	mr1619	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	4.71E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	4.90E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.93E-25	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.56E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	6.84E-22	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	2.46E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	2.24E-07	2.24E-07	mr1855	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	7.43E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.44E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	8.57E-11	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	3.83E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	2.31E-06	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	2.33E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.30E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	3.30E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.05E-17	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.39E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	3.85E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	5.17E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	1.56E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	2.40E-16	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	NA	3.04E-15	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711050248	3.20E-06	3.20E-06	mr1950_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251