Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711049866:

Variant ID: vg0711049866 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11049866
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCAGCGGGAGAGAGAGAGGAGAGCGGCGGCTTGGCTTGGTGGGCTAGCTGGGCCGGGCGCGCACAGGCCGGAGAGAGAGGGGTTTTGGGCCGACTTTCG[G/A]
CCCAAAGCCAAAAGAGGACTATTAAAACCTTTTTCTATTTAAATTATTCGTGAAATGCAATTCCATTTATTAAAAATACTTCCTTGGCTCAAATGAATCC

Reverse complement sequence

GGATTCATTTGAGCCAAGGAAGTATTTTTAATAAATGGAATTGCATTTCACGAATAATTTAAATAGAAAAAGGTTTTAATAGTCCTCTTTTGGCTTTGGG[C/T]
CGAAAGTCGGCCCAAAACCCCTCTCTCTCCGGCCTGTGCGCGCCCGGCCCAGCTAGCCCACCAAGCCAAGCCGCCGCTCTCCTCTCTCTCTCCCGCTGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.50%	27.20%	0.34%	8.97%	NA
All Indica	2759	96.70%	1.20%	0.29%	1.88%	NA
All Japonica	1512	1.80%	79.10%	0.33%	18.78%	NA
Aus	269	90.30%	4.80%	0.00%	4.83%	NA
Indica I	595	99.00%	0.50%	0.50%	0.00%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	99.70%	0.10%	0.11%	0.11%	NA
Indica Intermediate	786	91.50%	1.70%	0.38%	6.49%	NA
Temperate Japonica	767	1.70%	66.00%	0.52%	31.81%	NA
Tropical Japonica	504	0.80%	98.80%	0.00%	0.40%	NA
Japonica Intermediate	241	4.10%	79.70%	0.41%	15.77%	NA
VI/Aromatic	96	16.70%	6.20%	3.12%	73.96%	NA
Intermediate	90	53.30%	42.20%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711049866	G -> DEL	N	N	silent_mutation	Average:51.608; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0711049866	G -> A	LOC_Os07g18690.1	upstream_gene_variant ; 2064.0bp to feature; MODIFIER	silent_mutation	Average:51.608; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0711049866	G -> A	LOC_Os07g18700.1	downstream_gene_variant ; 1071.0bp to feature; MODIFIER	silent_mutation	Average:51.608; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0711049866	G -> A	LOC_Os07g18690-LOC_Os07g18700	intergenic_region ; MODIFIER	silent_mutation	Average:51.608; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711049866	4.05E-06	1.09E-76	mr1100	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	9.75E-07	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	3.60E-27	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	1.17E-28	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	8.25E-18	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	1.54E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	7.36E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	2.99E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	3.21E-06	3.21E-06	mr1855	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	2.40E-15	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	1.84E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	6.22E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	7.91E-06	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	6.76E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	4.58E-19	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	1.13E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	3.03E-07	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	1.09E-27	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	4.15E-26	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	4.10E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	5.15E-07	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	1.64E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	1.55E-32	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	7.38E-21	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	2.74E-20	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	6.56E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	5.82E-07	5.82E-07	mr1950_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711049866	NA	9.19E-12	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251