\
| Variant ID: vg0711041333 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11041333 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCCCCTTATATAGATGTAGGTATGACGGTTGTGGAAGGGGAAATGTCCGAAGTACCCTCCAACCGCCATCAGGAACACATCATGATGTGCACTAGGGTTC[C/T]
CGATCTTCCGAAAGGTTCTGATAAACAACGATTTGGGAGGAGTCGCGACACAAATTGATCCGGCTTCTTGAATGCGTACGCTCTTGAGACCCACAATCGC
GCGATTGTGGGTCTCAAGAGCGTACGCATTCAAGAAGCCGGATCAATTTGTGTCGCGACTCCTCCCAAATCGTTGTTTATCAGAACCTTTCGGAAGATCG[G/A]
GAACCCTAGTGCACATCATGATGTGTTCCTGATGGCGGTTGGAGGGTACTTCGGACATTTCCCCTTCCACAACCGTCATACCTACATCTATATAAGGGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 37.60% | 0.15% | 9.14% | NA |
| All Indica | 2759 | 80.90% | 16.90% | 0.04% | 2.17% | NA |
| All Japonica | 1512 | 1.90% | 79.10% | 0.20% | 18.85% | NA |
| Aus | 269 | 72.90% | 21.90% | 0.00% | 5.20% | NA |
| Indica I | 595 | 66.70% | 32.90% | 0.17% | 0.17% | NA |
| Indica II | 465 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.00% | 5.90% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 72.60% | 20.00% | 0.00% | 7.38% | NA |
| Temperate Japonica | 767 | 2.00% | 65.80% | 0.39% | 31.81% | NA |
| Tropical Japonica | 504 | 0.80% | 98.60% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 3.70% | 80.50% | 0.00% | 15.77% | NA |
| VI/Aromatic | 96 | 17.70% | 8.30% | 2.08% | 71.88% | NA |
| Intermediate | 90 | 43.30% | 51.10% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711041333 | C -> DEL | N | N | silent_mutation | Average:35.912; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0711041333 | C -> T | LOC_Os07g18680.1 | upstream_gene_variant ; 949.0bp to feature; MODIFIER | silent_mutation | Average:35.912; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0711041333 | C -> T | LOC_Os07g18690.1 | downstream_gene_variant ; 469.0bp to feature; MODIFIER | silent_mutation | Average:35.912; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0711041333 | C -> T | LOC_Os07g18680-LOC_Os07g18690 | intergenic_region ; MODIFIER | silent_mutation | Average:35.912; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711041333 | 1.09E-06 | 2.50E-13 | mr1270 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711041333 | 9.74E-06 | 9.74E-06 | mr1270 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711041333 | 9.49E-06 | 9.48E-06 | mr1575 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711041333 | NA | 1.81E-20 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |