\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710985476:

Variant ID: vg0710985476 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10985476
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAGCGCGAGGTCCAACTCACTGTGCGCCATCTCCAGCCTCTCCATGTTGTGCCTTTTGGATGCCTTCTCTGTCCGGTTGCTGGATAGGTAGGAGAAGA[C/T]
TCCGCTGACGGTTTCCTGGACAACGGCTGATGCAACTGCTTCTGCCATGAGAAAACTAAAACAAGAGGTGTCGCATAGCTAGCGTGATAATTCGATCCTC

Reverse complement sequence

GAGGATCGAATTATCACGCTAGCTATGCGACACCTCTTGTTTTAGTTTTCTCATGGCAGAAGCAGTTGCATCAGCCGTTGTCCAGGAAACCGTCAGCGGA[G/A]
TCTTCTCCTACCTATCCAGCAACCGGACAGAGAAGGCATCCAAAAGGCACAACATGGAGAGGCTGGAGATGGCGCACAGTGAGTTGGACCTCGCGCTCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.40% 8.90% 0.59% 55.12% NA
All Indica  2759 3.90% 12.10% 0.72% 83.25% NA
All Japonica  1512 93.80% 4.60% 0.13% 1.46% NA
Aus  269 10.00% 0.00% 1.49% 88.48% NA
Indica I  595 1.00% 32.80% 0.34% 65.88% NA
Indica II  465 4.30% 5.80% 1.29% 88.60% NA
Indica III  913 0.40% 1.20% 0.66% 97.70% NA
Indica Intermediate  786 9.80% 13.00% 0.76% 76.46% NA
Temperate Japonica  767 98.20% 0.10% 0.13% 1.56% NA
Tropical Japonica  504 86.50% 12.90% 0.00% 0.60% NA
Japonica Intermediate  241 95.00% 1.70% 0.41% 2.90% NA
VI/Aromatic  96 80.20% 6.20% 0.00% 13.54% NA
Intermediate  90 48.90% 10.00% 2.22% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710985476 C -> DEL LOC_Os07g18570.1 N frameshift_variant Average:13.483; most accessible tissue: Callus, score: 87.021 N N N N
vg0710985476 C -> T LOC_Os07g18570.1 missense_variant ; p.Val17Ile; MODERATE nonsynonymous_codon ; V17I Average:13.483; most accessible tissue: Callus, score: 87.021 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710985476 NA 4.81E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 1.38E-06 1.38E-06 mr1081_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 3.21E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 2.96E-06 NA mr1118_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 1.03E-14 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 2.30E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 6.50E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 4.35E-07 8.99E-08 mr1256_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 6.60E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 3.30E-06 3.29E-06 mr1405_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 5.26E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 6.52E-06 6.52E-06 mr1591_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 5.58E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 5.46E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 7.02E-06 mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 1.38E-06 1.38E-06 mr1783_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 6.64E-06 6.64E-06 mr1804_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 1.25E-06 9.90E-08 mr1835_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 4.17E-06 4.17E-06 mr1852_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 3.63E-06 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 6.12E-06 NA mr1891_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 5.86E-09 5.86E-09 mr1891_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 4.22E-06 4.36E-07 mr1922_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 6.21E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710985476 NA 2.20E-07 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251