\
| Variant ID: vg0710985476 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10985476 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 116. )
TCGAGCGCGAGGTCCAACTCACTGTGCGCCATCTCCAGCCTCTCCATGTTGTGCCTTTTGGATGCCTTCTCTGTCCGGTTGCTGGATAGGTAGGAGAAGA[C/T]
TCCGCTGACGGTTTCCTGGACAACGGCTGATGCAACTGCTTCTGCCATGAGAAAACTAAAACAAGAGGTGTCGCATAGCTAGCGTGATAATTCGATCCTC
GAGGATCGAATTATCACGCTAGCTATGCGACACCTCTTGTTTTAGTTTTCTCATGGCAGAAGCAGTTGCATCAGCCGTTGTCCAGGAAACCGTCAGCGGA[G/A]
TCTTCTCCTACCTATCCAGCAACCGGACAGAGAAGGCATCCAAAAGGCACAACATGGAGAGGCTGGAGATGGCGCACAGTGAGTTGGACCTCGCGCTCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.40% | 8.90% | 0.59% | 55.12% | NA |
| All Indica | 2759 | 3.90% | 12.10% | 0.72% | 83.25% | NA |
| All Japonica | 1512 | 93.80% | 4.60% | 0.13% | 1.46% | NA |
| Aus | 269 | 10.00% | 0.00% | 1.49% | 88.48% | NA |
| Indica I | 595 | 1.00% | 32.80% | 0.34% | 65.88% | NA |
| Indica II | 465 | 4.30% | 5.80% | 1.29% | 88.60% | NA |
| Indica III | 913 | 0.40% | 1.20% | 0.66% | 97.70% | NA |
| Indica Intermediate | 786 | 9.80% | 13.00% | 0.76% | 76.46% | NA |
| Temperate Japonica | 767 | 98.20% | 0.10% | 0.13% | 1.56% | NA |
| Tropical Japonica | 504 | 86.50% | 12.90% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 95.00% | 1.70% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 80.20% | 6.20% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 48.90% | 10.00% | 2.22% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710985476 | C -> DEL | LOC_Os07g18570.1 | N | frameshift_variant | Average:13.483; most accessible tissue: Callus, score: 87.021 | N | N | N | N |
| vg0710985476 | C -> T | LOC_Os07g18570.1 | missense_variant ; p.Val17Ile; MODERATE | nonsynonymous_codon ; V17I | Average:13.483; most accessible tissue: Callus, score: 87.021 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710985476 | NA | 4.81E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 1.38E-06 | 1.38E-06 | mr1081_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 3.21E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 2.96E-06 | NA | mr1118_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 1.03E-14 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 2.30E-06 | mr1148_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 6.50E-06 | mr1194_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 4.35E-07 | 8.99E-08 | mr1256_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 6.60E-06 | mr1381_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 3.30E-06 | 3.29E-06 | mr1405_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 5.26E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 6.52E-06 | 6.52E-06 | mr1591_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 5.58E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 5.46E-06 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 7.02E-06 | mr1754_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 1.38E-06 | 1.38E-06 | mr1783_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 6.64E-06 | 6.64E-06 | mr1804_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 1.25E-06 | 9.90E-08 | mr1835_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 4.17E-06 | 4.17E-06 | mr1852_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 3.63E-06 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 6.12E-06 | NA | mr1891_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 5.86E-09 | 5.86E-09 | mr1891_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | 4.22E-06 | 4.36E-07 | mr1922_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 6.21E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710985476 | NA | 2.20E-07 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |