\
| Variant ID: vg0710971660 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 10971660 |
| Reference Allele: TG | Alternative Allele: AG,T |
| Primary Allele: TG | Secondary Allele: AG |
Inferred Ancestral Allele: Not determined.
GACTCCTAGTATGAATTTGGTTCGTGGCTTTAGGCTGCCTACCTCAGGTATAAATAGAGGGGGAGTGTGAGGCTTCCCGGTATCGCTTTTGTATCGCTTT[TG/AG,T]
AGAGCAATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTTAAGGAGTGTTGTTGGTGCACTTTGTAAACACAGAGAGAAGTAATAA
TTATTACTTCTCTCTGTGTTTACAAAGTGCACCAACAACACTCCTTAAAAAATTTCGACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATTGCTCT[CA/CT,A]
AAAGCGATACAAAAGCGATACCGGGAAGCCTCACACTCCCCCTCTATTTATACCTGAGGTAGGCAGCCTAAAGCCACGAACCAAATTCATACTAGGAGTC
| Populations | Population Size | Frequency of TG(primary allele) | Frequency of AG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 0.10% | 0.30% | 8.53% | T: 0.02% |
| All Indica | 2759 | 96.30% | 0.10% | 0.29% | 3.33% | T: 0.04% |
| All Japonica | 1512 | 83.10% | 0.00% | 0.20% | 16.73% | NA |
| Aus | 269 | 92.90% | 0.00% | 1.12% | 5.95% | NA |
| Indica I | 595 | 98.30% | 0.00% | 0.34% | 1.34% | NA |
| Indica II | 465 | 94.60% | 0.00% | 0.86% | 4.52% | NA |
| Indica III | 913 | 96.40% | 0.20% | 0.00% | 3.40% | NA |
| Indica Intermediate | 786 | 95.50% | 0.00% | 0.25% | 4.07% | T: 0.13% |
| Temperate Japonica | 767 | 70.80% | 0.00% | 0.39% | 28.81% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 87.60% | 0.00% | 0.00% | 12.45% | NA |
| VI/Aromatic | 96 | 57.30% | 0.00% | 0.00% | 42.71% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710971660 | TG -> AG | LOC_Os07g18530.1 | upstream_gene_variant ; 3632.0bp to feature; MODIFIER | silent_mutation | Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0710971660 | TG -> AG | LOC_Os07g18550.1 | downstream_gene_variant ; 3729.0bp to feature; MODIFIER | silent_mutation | Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0710971660 | TG -> AG | LOC_Os07g18540.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0710971660 | TG -> DEL | N | N | silent_mutation | Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0710971660 | TG -> T | LOC_Os07g18530.1 | upstream_gene_variant ; 3633.0bp to feature; MODIFIER | silent_mutation | Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0710971660 | TG -> T | LOC_Os07g18550.1 | downstream_gene_variant ; 3728.0bp to feature; MODIFIER | silent_mutation | Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0710971660 | TG -> T | LOC_Os07g18540.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710971660 | NA | 1.47E-16 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0710971660 | NA | 8.97E-13 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 8.80E-12 | mr1624 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 2.41E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 7.91E-14 | mr1624_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 9.85E-12 | mr1624_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 1.04E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 3.58E-08 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 5.91E-10 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 5.95E-07 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 1.73E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710971660 | NA | 3.86E-06 | mr1887_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |