\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710971660:

Variant ID: vg0710971660 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 10971660
Reference Allele: TGAlternative Allele: AG,T
Primary Allele: TGSecondary Allele: AG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTCCTAGTATGAATTTGGTTCGTGGCTTTAGGCTGCCTACCTCAGGTATAAATAGAGGGGGAGTGTGAGGCTTCCCGGTATCGCTTTTGTATCGCTTT[TG/AG,T]
AGAGCAATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTTAAGGAGTGTTGTTGGTGCACTTTGTAAACACAGAGAGAAGTAATAA

Reverse complement sequence

TTATTACTTCTCTCTGTGTTTACAAAGTGCACCAACAACACTCCTTAAAAAATTTCGACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATTGCTCT[CA/CT,A]
AAAGCGATACAAAAGCGATACCGGGAAGCCTCACACTCCCCCTCTATTTATACCTGAGGTAGGCAGCCTAAAGCCACGAACCAAATTCATACTAGGAGTC

Allele Frequencies:

Populations Population SizeFrequency of TG(primary allele) Frequency of AG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 0.10% 0.30% 8.53% T: 0.02%
All Indica  2759 96.30% 0.10% 0.29% 3.33% T: 0.04%
All Japonica  1512 83.10% 0.00% 0.20% 16.73% NA
Aus  269 92.90% 0.00% 1.12% 5.95% NA
Indica I  595 98.30% 0.00% 0.34% 1.34% NA
Indica II  465 94.60% 0.00% 0.86% 4.52% NA
Indica III  913 96.40% 0.20% 0.00% 3.40% NA
Indica Intermediate  786 95.50% 0.00% 0.25% 4.07% T: 0.13%
Temperate Japonica  767 70.80% 0.00% 0.39% 28.81% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 87.60% 0.00% 0.00% 12.45% NA
VI/Aromatic  96 57.30% 0.00% 0.00% 42.71% NA
Intermediate  90 97.80% 1.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710971660 TG -> AG LOC_Os07g18530.1 upstream_gene_variant ; 3632.0bp to feature; MODIFIER silent_mutation Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0710971660 TG -> AG LOC_Os07g18550.1 downstream_gene_variant ; 3729.0bp to feature; MODIFIER silent_mutation Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0710971660 TG -> AG LOC_Os07g18540.1 intron_variant ; MODIFIER silent_mutation Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0710971660 TG -> DEL N N silent_mutation Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0710971660 TG -> T LOC_Os07g18530.1 upstream_gene_variant ; 3633.0bp to feature; MODIFIER silent_mutation Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0710971660 TG -> T LOC_Os07g18550.1 downstream_gene_variant ; 3728.0bp to feature; MODIFIER silent_mutation Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0710971660 TG -> T LOC_Os07g18540.1 intron_variant ; MODIFIER silent_mutation Average:29.112; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710971660 NA 1.47E-16 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0710971660 NA 8.97E-13 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 8.80E-12 mr1624 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 2.41E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 7.91E-14 mr1624_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 9.85E-12 mr1624_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 1.04E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 3.58E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 5.91E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 5.95E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 1.73E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710971660 NA 3.86E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251