\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710900579:

Variant ID: vg0710900579 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10900579
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAAACACAATGTGTAGCAACGTTTGTTCAAATATATAACAAGTAAATCTAATATAGAACATATGCACCTTTGGTTGACTCATATATAAGGTAGTCATG[G/A]
TTATATCCGAGCTAGTTGTGTACTCATCACCTTCGGCCCAGGCATCAAGAGCACTTGATATGTGTAGTGAGATGCGGCCATGAACTTCGCGAGAGCAGTT

Reverse complement sequence

AACTGCTCTCGCGAAGTTCATGGCCGCATCTCACTACACATATCAAGTGCTCTTGATGCCTGGGCCGAAGGTGATGAGTACACAACTAGCTCGGATATAA[C/T]
CATGACTACCTTATATATGAGTCAACCAAAGGTGCATATGTTCTATATTAGATTTACTTGTTATATATTTGAACAAACGTTGCTACACATTGTGTTTCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.50% 0.10% 5.08% 57.34% NA
All Indica  2759 12.60% 0.10% 7.25% 79.99% NA
All Japonica  1512 79.00% 0.10% 0.73% 20.17% NA
Aus  269 65.10% 0.00% 6.32% 28.62% NA
Indica I  595 8.10% 0.00% 4.03% 87.90% NA
Indica II  465 15.10% 0.90% 9.03% 75.05% NA
Indica III  913 13.00% 0.00% 9.64% 77.33% NA
Indica Intermediate  786 14.10% 0.00% 5.85% 80.03% NA
Temperate Japonica  767 72.60% 0.00% 0.91% 26.47% NA
Tropical Japonica  504 86.90% 0.20% 0.20% 12.70% NA
Japonica Intermediate  241 83.00% 0.00% 1.24% 15.77% NA
VI/Aromatic  96 8.30% 1.00% 6.25% 84.38% NA
Intermediate  90 48.90% 0.00% 6.67% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710900579 G -> DEL N N silent_mutation Average:11.567; most accessible tissue: Callus, score: 28.091 N N N N
vg0710900579 G -> A LOC_Os07g18400.1 upstream_gene_variant ; 2558.0bp to feature; MODIFIER silent_mutation Average:11.567; most accessible tissue: Callus, score: 28.091 N N N N
vg0710900579 G -> A LOC_Os07g18390.1 downstream_gene_variant ; 4899.0bp to feature; MODIFIER silent_mutation Average:11.567; most accessible tissue: Callus, score: 28.091 N N N N
vg0710900579 G -> A LOC_Os07g18420.1 downstream_gene_variant ; 952.0bp to feature; MODIFIER silent_mutation Average:11.567; most accessible tissue: Callus, score: 28.091 N N N N
vg0710900579 G -> A LOC_Os07g18410.1 intron_variant ; MODIFIER silent_mutation Average:11.567; most accessible tissue: Callus, score: 28.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710900579 NA 2.45E-16 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 1.66E-15 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 8.56E-06 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 1.84E-16 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 2.56E-11 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 2.74E-17 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 1.02E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 8.76E-06 NA mr1079 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 3.74E-19 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 3.98E-15 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 1.33E-14 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 4.18E-16 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 1.77E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 2.77E-06 NA mr1390 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 5.34E-19 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 1.53E-08 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 2.00E-06 NA mr1490 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 3.34E-18 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 2.54E-12 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 4.26E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 5.00E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 1.29E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 4.12E-08 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 1.79E-15 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 9.24E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 6.76E-17 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 7.58E-16 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 8.17E-14 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 3.57E-17 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 8.49E-17 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 7.81E-15 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579 NA 5.29E-08 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251