Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0710900579:

Variant ID: vg0710900579 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10900579
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGAAACACAATGTGTAGCAACGTTTGTTCAAATATATAACAAGTAAATCTAATATAGAACATATGCACCTTTGGTTGACTCATATATAAGGTAGTCATG[G/A]
TTATATCCGAGCTAGTTGTGTACTCATCACCTTCGGCCCAGGCATCAAGAGCACTTGATATGTGTAGTGAGATGCGGCCATGAACTTCGCGAGAGCAGTT

Reverse complement sequence

AACTGCTCTCGCGAAGTTCATGGCCGCATCTCACTACACATATCAAGTGCTCTTGATGCCTGGGCCGAAGGTGATGAGTACACAACTAGCTCGGATATAA[C/T]
CATGACTACCTTATATATGAGTCAACCAAAGGTGCATATGTTCTATATTAGATTTACTTGTTATATATTTGAACAAACGTTGCTACACATTGTGTTTCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.50%	0.10%	5.08%	57.34%	NA
All Indica	2759	12.60%	0.10%	7.25%	79.99%	NA
All Japonica	1512	79.00%	0.10%	0.73%	20.17%	NA
Aus	269	65.10%	0.00%	6.32%	28.62%	NA
Indica I	595	8.10%	0.00%	4.03%	87.90%	NA
Indica II	465	15.10%	0.90%	9.03%	75.05%	NA
Indica III	913	13.00%	0.00%	9.64%	77.33%	NA
Indica Intermediate	786	14.10%	0.00%	5.85%	80.03%	NA
Temperate Japonica	767	72.60%	0.00%	0.91%	26.47%	NA
Tropical Japonica	504	86.90%	0.20%	0.20%	12.70%	NA
Japonica Intermediate	241	83.00%	0.00%	1.24%	15.77%	NA
VI/Aromatic	96	8.30%	1.00%	6.25%	84.38%	NA
Intermediate	90	48.90%	0.00%	6.67%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710900579	G -> DEL	N	N	silent_mutation	Average:11.567; most accessible tissue: Callus, score: 28.091	N	N	N	N
vg0710900579	G -> A	LOC_Os07g18400.1	upstream_gene_variant ; 2558.0bp to feature; MODIFIER	silent_mutation	Average:11.567; most accessible tissue: Callus, score: 28.091	N	N	N	N
vg0710900579	G -> A	LOC_Os07g18390.1	downstream_gene_variant ; 4899.0bp to feature; MODIFIER	silent_mutation	Average:11.567; most accessible tissue: Callus, score: 28.091	N	N	N	N
vg0710900579	G -> A	LOC_Os07g18420.1	downstream_gene_variant ; 952.0bp to feature; MODIFIER	silent_mutation	Average:11.567; most accessible tissue: Callus, score: 28.091	N	N	N	N
vg0710900579	G -> A	LOC_Os07g18410.1	intron_variant ; MODIFIER	silent_mutation	Average:11.567; most accessible tissue: Callus, score: 28.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710900579	NA	2.45E-16	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	1.66E-15	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	8.56E-06	mr1018	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	1.84E-16	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	2.56E-11	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	2.74E-17	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	1.02E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	8.76E-06	NA	mr1079	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	3.74E-19	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	3.98E-15	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	1.33E-14	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	4.18E-16	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	1.77E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	2.77E-06	NA	mr1390	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	5.34E-19	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	1.53E-08	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	2.00E-06	NA	mr1490	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	3.34E-18	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	2.54E-12	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	4.26E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	5.00E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	1.29E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	4.12E-08	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	1.79E-15	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	9.24E-11	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	6.76E-17	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	7.58E-16	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	8.17E-14	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	3.57E-17	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	8.49E-17	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	7.81E-15	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900579	NA	5.29E-08	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251