\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710900359:

Variant ID: vg0710900359 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10900359
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTTTGAAATAGATGCTGTCAGAAGGCCCGAATCTGAATCCAAAACATGTACAACTTGATCTCTTGTCTTCTATAGGCCAAAAGTGACGTGGTGAGGTA[G/T]
AAGTATACTTGGAGAAGGTCTTGGTTTGGTCCCCAATCAACTTCTTCAGTCATCCATGCATTCCTTACGCTCGGTCTCTTTTCTTTCCCCCAAGCAAGTA

Reverse complement sequence

TACTTGCTTGGGGGAAAGAAAAGAGACCGAGCGTAAGGAATGCATGGATGACTGAAGAAGTTGATTGGGGACCAAACCAAGACCTTCTCCAAGTATACTT[C/A]
TACCTCACCACGTCACTTTTGGCCTATAGAAGACAAGAGATCAAGTTGTACATGTTTTGGATTCAGATTCGGGCCTTCTGACAGCATCTATTTCAAACGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 1.00% 1.90% 63.99% NA
All Indica  2759 6.40% 1.60% 2.68% 89.27% NA
All Japonica  1512 78.40% 0.10% 0.40% 21.10% NA
Aus  269 57.60% 0.00% 1.86% 40.52% NA
Indica I  595 6.40% 1.20% 1.51% 90.92% NA
Indica II  465 10.10% 0.60% 3.44% 85.81% NA
Indica III  913 2.80% 2.50% 3.29% 91.35% NA
Indica Intermediate  786 8.40% 1.50% 2.42% 87.66% NA
Temperate Japonica  767 71.70% 0.10% 0.52% 27.64% NA
Tropical Japonica  504 86.30% 0.20% 0.20% 13.29% NA
Japonica Intermediate  241 83.00% 0.00% 0.41% 16.60% NA
VI/Aromatic  96 8.30% 2.10% 3.12% 86.46% NA
Intermediate  90 42.20% 0.00% 2.22% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710900359 G -> DEL N N silent_mutation Average:10.688; most accessible tissue: Callus, score: 30.271 N N N N
vg0710900359 G -> T LOC_Os07g18400.1 upstream_gene_variant ; 2338.0bp to feature; MODIFIER silent_mutation Average:10.688; most accessible tissue: Callus, score: 30.271 N N N N
vg0710900359 G -> T LOC_Os07g18390.1 downstream_gene_variant ; 4679.0bp to feature; MODIFIER silent_mutation Average:10.688; most accessible tissue: Callus, score: 30.271 N N N N
vg0710900359 G -> T LOC_Os07g18420.1 downstream_gene_variant ; 1172.0bp to feature; MODIFIER silent_mutation Average:10.688; most accessible tissue: Callus, score: 30.271 N N N N
vg0710900359 G -> T LOC_Os07g18410.1 intron_variant ; MODIFIER silent_mutation Average:10.688; most accessible tissue: Callus, score: 30.271 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710900359 NA 7.60E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0710900359 NA 3.74E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 7.90E-07 NA mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 1.82E-06 NA mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 5.47E-06 NA mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 3.32E-06 NA mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 3.73E-07 1.90E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 NA 5.50E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 NA 1.35E-06 mr1677 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 8.72E-08 2.69E-07 mr1917 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 6.50E-07 1.92E-08 mr1936 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 9.54E-06 9.54E-06 mr1950 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 NA 1.78E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710900359 NA 3.04E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251