| Variant ID: vg0710897803 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10897803 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 34. )
TCCATCAAATCTTTTTTCCAGCTTCCTGAGTACTTCTGCGAGGTACTTGGATAACTCTACCTCGGGGCTAGACCACTTGTAGTCTTTGTGCACCTGGTTT[G/A]
CGACTAGTTCGGAATCCCCTTTTACGATCAGTCGCTTGACTCCAAGTGCGGCTGCTGCTCTTATCCCAGTGAGTAGTCCTTAGTATTCGGTAGTGTTGTT
AACAACACTACCGAATACTAAGGACTACTCACTGGGATAAGAGCAGCAGCCGCACTTGGAGTCAAGCGACTGATCGTAAAAGGGGATTCCGAACTAGTCG[C/T]
AAACCAGGTGCACAAAGACTACAAGTGGTCTAGCCCCGAGGTAGAGTTATCCAAGTACCTCGCAGAAGTACTCAGGAAGCTGGAAAAAAGATTTGATGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.70% | 8.10% | 10.94% | 1.27% | NA |
| All Indica | 2759 | 69.70% | 13.70% | 14.93% | 1.70% | NA |
| All Japonica | 1512 | 92.80% | 0.10% | 6.42% | 0.73% | NA |
| Aus | 269 | 98.50% | 0.40% | 1.12% | 0.00% | NA |
| Indica I | 595 | 44.70% | 26.70% | 27.56% | 1.01% | NA |
| Indica II | 465 | 75.70% | 8.60% | 13.55% | 2.15% | NA |
| Indica III | 913 | 82.80% | 8.40% | 6.79% | 1.97% | NA |
| Indica Intermediate | 786 | 69.80% | 12.80% | 15.65% | 1.65% | NA |
| Temperate Japonica | 767 | 86.30% | 0.10% | 12.13% | 1.43% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 3.30% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710897803 | G -> DEL | N | N | silent_mutation | Average:20.985; most accessible tissue: Callus, score: 39.295 | N | N | N | N |
| vg0710897803 | G -> A | LOC_Os07g18390.1 | downstream_gene_variant ; 2123.0bp to feature; MODIFIER | silent_mutation | Average:20.985; most accessible tissue: Callus, score: 39.295 | N | N | N | N |
| vg0710897803 | G -> A | LOC_Os07g18410.1 | downstream_gene_variant ; 971.0bp to feature; MODIFIER | silent_mutation | Average:20.985; most accessible tissue: Callus, score: 39.295 | N | N | N | N |
| vg0710897803 | G -> A | LOC_Os07g18420.1 | downstream_gene_variant ; 3728.0bp to feature; MODIFIER | silent_mutation | Average:20.985; most accessible tissue: Callus, score: 39.295 | N | N | N | N |
| vg0710897803 | G -> A | LOC_Os07g18400.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.985; most accessible tissue: Callus, score: 39.295 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710897803 | NA | 1.38E-10 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710897803 | NA | 9.25E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710897803 | 1.35E-06 | 4.21E-17 | mr1118 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710897803 | NA | 5.36E-11 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710897803 | NA | 6.10E-06 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710897803 | NA | 3.20E-18 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710897803 | NA | 2.97E-09 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710897803 | NA | 4.00E-14 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710897803 | NA | 5.74E-16 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710897803 | NA | 2.12E-06 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/