Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710897803:

Variant ID: vg0710897803 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10897803
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:

TCCATCAAATCTTTTTTCCAGCTTCCTGAGTACTTCTGCGAGGTACTTGGATAACTCTACCTCGGGGCTAGACCACTTGTAGTCTTTGTGCACCTGGTTT[G/A]
CGACTAGTTCGGAATCCCCTTTTACGATCAGTCGCTTGACTCCAAGTGCGGCTGCTGCTCTTATCCCAGTGAGTAGTCCTTAGTATTCGGTAGTGTTGTT

Reverse complement sequence

AACAACACTACCGAATACTAAGGACTACTCACTGGGATAAGAGCAGCAGCCGCACTTGGAGTCAAGCGACTGATCGTAAAAGGGGATTCCGAACTAGTCG[C/T]
AAACCAGGTGCACAAAGACTACAAGTGGTCTAGCCCCGAGGTAGAGTTATCCAAGTACCTCGCAGAAGTACTCAGGAAGCTGGAAAAAAGATTTGATGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.70%	8.10%	10.94%	1.27%	NA
All Indica	2759	69.70%	13.70%	14.93%	1.70%	NA
All Japonica	1512	92.80%	0.10%	6.42%	0.73%	NA
Aus	269	98.50%	0.40%	1.12%	0.00%	NA
Indica I	595	44.70%	26.70%	27.56%	1.01%	NA
Indica II	465	75.70%	8.60%	13.55%	2.15%	NA
Indica III	913	82.80%	8.40%	6.79%	1.97%	NA
Indica Intermediate	786	69.80%	12.80%	15.65%	1.65%	NA
Temperate Japonica	767	86.30%	0.10%	12.13%	1.43%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	0.00%	1.24%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	90.00%	3.30%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710897803	G -> DEL	N	N	silent_mutation	Average:20.985; most accessible tissue: Callus, score: 39.295	N	N	N	N
vg0710897803	G -> A	LOC_Os07g18390.1	downstream_gene_variant ; 2123.0bp to feature; MODIFIER	silent_mutation	Average:20.985; most accessible tissue: Callus, score: 39.295	N	N	N	N
vg0710897803	G -> A	LOC_Os07g18410.1	downstream_gene_variant ; 971.0bp to feature; MODIFIER	silent_mutation	Average:20.985; most accessible tissue: Callus, score: 39.295	N	N	N	N
vg0710897803	G -> A	LOC_Os07g18420.1	downstream_gene_variant ; 3728.0bp to feature; MODIFIER	silent_mutation	Average:20.985; most accessible tissue: Callus, score: 39.295	N	N	N	N
vg0710897803	G -> A	LOC_Os07g18400.1	intron_variant ; MODIFIER	silent_mutation	Average:20.985; most accessible tissue: Callus, score: 39.295	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710897803	NA	1.38E-10	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710897803	NA	9.25E-16	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710897803	1.35E-06	4.21E-17	mr1118	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710897803	NA	5.36E-11	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710897803	NA	6.10E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710897803	NA	3.20E-18	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710897803	NA	2.97E-09	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710897803	NA	4.00E-14	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710897803	NA	5.74E-16	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710897803	NA	2.12E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251