\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710883859:

Variant ID: vg0710883859 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10883859
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGTATTACAACCTTATGGCTGATAAGAGGGAGGATTTGGTTCAGTCACGATTGCGAGCCCTTGCGAAGGTTATTAAGGATAAGGAATGTGTTGCTCGG[C/T]
ATTATAATAAGAAAGTGGTACCTAAAGATTTTTCGGAAGGAGAACTTGTATGGAAGCTGATTTTGCCGATTGGTACTCGTGATAGTAAATTCGGCAAGTG

Reverse complement sequence

CACTTGCCGAATTTACTATCACGAGTACCAATCGGCAAAATCAGCTTCCATACAAGTTCTCCTTCCGAAAAATCTTTAGGTACCACTTTCTTATTATAAT[G/A]
CCGAGCAACACATTCCTTATCCTTAATAACCTTCGCAAGGGCTCGCAATCGTGACTGAACCAAATCCTCCCTCTTATCAGCCATAAGGTTGTAATACTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 1.30% 0.47% 4.51% NA
All Indica  2759 99.60% 0.00% 0.07% 0.33% NA
All Japonica  1512 83.10% 4.00% 1.26% 11.64% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 98.70% 0.00% 0.25% 1.02% NA
Temperate Japonica  767 71.80% 8.00% 2.09% 18.12% NA
Tropical Japonica  504 95.60% 0.00% 0.20% 4.17% NA
Japonica Intermediate  241 92.50% 0.00% 0.83% 6.64% NA
VI/Aromatic  96 70.80% 0.00% 1.04% 28.12% NA
Intermediate  90 97.80% 1.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710883859 C -> DEL N N silent_mutation Average:31.931; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg0710883859 C -> T LOC_Os07g18360.1 downstream_gene_variant ; 490.0bp to feature; MODIFIER silent_mutation Average:31.931; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg0710883859 C -> T LOC_Os07g18370.1 downstream_gene_variant ; 667.0bp to feature; MODIFIER silent_mutation Average:31.931; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg0710883859 C -> T LOC_Os07g18360-LOC_Os07g18370 intergenic_region ; MODIFIER silent_mutation Average:31.931; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710883859 NA 1.93E-09 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710883859 5.89E-07 5.89E-07 mr1369 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710883859 NA 1.15E-08 mr1453 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710883859 NA 4.99E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710883859 NA 2.79E-09 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710883859 NA 6.95E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710883859 NA 8.94E-06 mr1874_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251