| Variant ID: vg0710883859 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10883859 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGAGTATTACAACCTTATGGCTGATAAGAGGGAGGATTTGGTTCAGTCACGATTGCGAGCCCTTGCGAAGGTTATTAAGGATAAGGAATGTGTTGCTCGG[C/T]
ATTATAATAAGAAAGTGGTACCTAAAGATTTTTCGGAAGGAGAACTTGTATGGAAGCTGATTTTGCCGATTGGTACTCGTGATAGTAAATTCGGCAAGTG
CACTTGCCGAATTTACTATCACGAGTACCAATCGGCAAAATCAGCTTCCATACAAGTTCTCCTTCCGAAAAATCTTTAGGTACCACTTTCTTATTATAAT[G/A]
CCGAGCAACACATTCCTTATCCTTAATAACCTTCGCAAGGGCTCGCAATCGTGACTGAACCAAATCCTCCCTCTTATCAGCCATAAGGTTGTAATACTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 1.30% | 0.47% | 4.51% | NA |
| All Indica | 2759 | 99.60% | 0.00% | 0.07% | 0.33% | NA |
| All Japonica | 1512 | 83.10% | 4.00% | 1.26% | 11.64% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.70% | 0.00% | 0.25% | 1.02% | NA |
| Temperate Japonica | 767 | 71.80% | 8.00% | 2.09% | 18.12% | NA |
| Tropical Japonica | 504 | 95.60% | 0.00% | 0.20% | 4.17% | NA |
| Japonica Intermediate | 241 | 92.50% | 0.00% | 0.83% | 6.64% | NA |
| VI/Aromatic | 96 | 70.80% | 0.00% | 1.04% | 28.12% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710883859 | C -> DEL | N | N | silent_mutation | Average:31.931; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| vg0710883859 | C -> T | LOC_Os07g18360.1 | downstream_gene_variant ; 490.0bp to feature; MODIFIER | silent_mutation | Average:31.931; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| vg0710883859 | C -> T | LOC_Os07g18370.1 | downstream_gene_variant ; 667.0bp to feature; MODIFIER | silent_mutation | Average:31.931; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| vg0710883859 | C -> T | LOC_Os07g18360-LOC_Os07g18370 | intergenic_region ; MODIFIER | silent_mutation | Average:31.931; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710883859 | NA | 1.93E-09 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710883859 | 5.89E-07 | 5.89E-07 | mr1369 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710883859 | NA | 1.15E-08 | mr1453 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710883859 | NA | 4.99E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710883859 | NA | 2.79E-09 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710883859 | NA | 6.95E-07 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710883859 | NA | 8.94E-06 | mr1874_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/