Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710830838:

Variant ID: vg0710830838 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10830838
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.34, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

AATAGAACAATGCAACGGCTCAAATTGTCTAGGTAAAGAATAAATATTTTTGTGTGGCAATTTTCTGGTTATGGGAAGATAAATTACCTAACGGGCAACC[A/G]
CGCTCTGATACCAACTGATGAGGGATATTAGGTCCCGATCTTCCGATAGGTATTGATAAACAACGATTTGGGCGGAGTCGCGACACAACTCGATCCGGCT

Reverse complement sequence

AGCCGGATCGAGTTGTGTCGCGACTCCGCCCAAATCGTTGTTTATCAATACCTATCGGAAGATCGGGACCTAATATCCCTCATCAGTTGGTATCAGAGCG[T/C]
GGTTGCCCGTTAGGTAATTTATCTTCCCATAACCAGAAAATTGCCACACAAAAATATTTATTCTTTACCTAGACAATTTGAGCCGTTGCATTGTTCTATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	1.70%	3.53%	4.89%	NA
All Indica	2759	98.30%	0.40%	0.91%	0.40%	NA
All Japonica	1512	77.20%	1.10%	7.41%	14.29%	NA
Aus	269	90.70%	7.40%	1.86%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	94.40%	1.10%	3.05%	1.40%	NA
Temperate Japonica	767	70.50%	1.60%	8.87%	19.04%	NA
Tropical Japonica	504	92.70%	0.00%	0.79%	6.55%	NA
Japonica Intermediate	241	66.40%	1.70%	16.60%	15.35%	NA
VI/Aromatic	96	39.60%	35.40%	21.88%	3.12%	NA
Intermediate	90	92.20%	2.20%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710830838	A -> DEL	N	N	silent_mutation	Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0710830838	A -> G	LOC_Os07g18270.1	upstream_gene_variant ; 1240.0bp to feature; MODIFIER	silent_mutation	Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0710830838	A -> G	LOC_Os07g18260.1	downstream_gene_variant ; 3836.0bp to feature; MODIFIER	silent_mutation	Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0710830838	A -> G	LOC_Os07g18280.1	downstream_gene_variant ; 4006.0bp to feature; MODIFIER	silent_mutation	Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0710830838	A -> G	LOC_Os07g18270-LOC_Os07g18280	intergenic_region ; MODIFIER	silent_mutation	Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710830838	NA	4.87E-06	mr1677	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830838	4.24E-06	4.24E-06	mr1950	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830838	4.76E-06	NA	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830838	8.92E-06	1.95E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830838	NA	2.11E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251