\
| Variant ID: vg0710830838 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10830838 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.34, others allele: 0.00, population size: 182. )
AATAGAACAATGCAACGGCTCAAATTGTCTAGGTAAAGAATAAATATTTTTGTGTGGCAATTTTCTGGTTATGGGAAGATAAATTACCTAACGGGCAACC[A/G]
CGCTCTGATACCAACTGATGAGGGATATTAGGTCCCGATCTTCCGATAGGTATTGATAAACAACGATTTGGGCGGAGTCGCGACACAACTCGATCCGGCT
AGCCGGATCGAGTTGTGTCGCGACTCCGCCCAAATCGTTGTTTATCAATACCTATCGGAAGATCGGGACCTAATATCCCTCATCAGTTGGTATCAGAGCG[T/C]
GGTTGCCCGTTAGGTAATTTATCTTCCCATAACCAGAAAATTGCCACACAAAAATATTTATTCTTTACCTAGACAATTTGAGCCGTTGCATTGTTCTATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 1.70% | 3.53% | 4.89% | NA |
| All Indica | 2759 | 98.30% | 0.40% | 0.91% | 0.40% | NA |
| All Japonica | 1512 | 77.20% | 1.10% | 7.41% | 14.29% | NA |
| Aus | 269 | 90.70% | 7.40% | 1.86% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 1.10% | 3.05% | 1.40% | NA |
| Temperate Japonica | 767 | 70.50% | 1.60% | 8.87% | 19.04% | NA |
| Tropical Japonica | 504 | 92.70% | 0.00% | 0.79% | 6.55% | NA |
| Japonica Intermediate | 241 | 66.40% | 1.70% | 16.60% | 15.35% | NA |
| VI/Aromatic | 96 | 39.60% | 35.40% | 21.88% | 3.12% | NA |
| Intermediate | 90 | 92.20% | 2.20% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710830838 | A -> DEL | N | N | silent_mutation | Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0710830838 | A -> G | LOC_Os07g18270.1 | upstream_gene_variant ; 1240.0bp to feature; MODIFIER | silent_mutation | Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0710830838 | A -> G | LOC_Os07g18260.1 | downstream_gene_variant ; 3836.0bp to feature; MODIFIER | silent_mutation | Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0710830838 | A -> G | LOC_Os07g18280.1 | downstream_gene_variant ; 4006.0bp to feature; MODIFIER | silent_mutation | Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0710830838 | A -> G | LOC_Os07g18270-LOC_Os07g18280 | intergenic_region ; MODIFIER | silent_mutation | Average:37.345; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710830838 | NA | 4.87E-06 | mr1677 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710830838 | 4.24E-06 | 4.24E-06 | mr1950 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710830838 | 4.76E-06 | NA | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710830838 | 8.92E-06 | 1.95E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710830838 | NA | 2.11E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |