Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710776650:

Variant ID: vg0710776650 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10776650
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.04, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTGTACTTATCAAATAAACAATATCTATATTAACTAATTTATATATGCACTTAAGCTGATGGCCCCATTATATAAATCATCGGATCTACTTTTTATTA[T/C]
ATTAGTCTATTATTCTCAAGTAATGGACTATTTCAAAATAAGGTCTACACCATTATATTGTGCATCCATTATATTAACAGTTTAAAATCTATATTAACTA

Reverse complement sequence

TAGTTAATATAGATTTTAAACTGTTAATATAATGGATGCACAATATAATGGTGTAGACCTTATTTTGAAATAGTCCATTACTTGAGAATAATAGACTAAT[A/G]
TAATAAAAAGTAGATCCGATGATTTATATAATGGGGCCATCAGCTTAAGTGCATATATAAATTAGTTAATATAGATATTGTTTATTTGATAAGTACACGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.80%	11.20%	1.16%	58.87%	NA
All Indica	2759	2.10%	16.50%	0.58%	80.90%	NA
All Japonica	1512	75.30%	0.10%	2.38%	22.22%	NA
Aus	269	49.10%	22.30%	0.74%	27.88%	NA
Indica I	595	2.00%	32.30%	1.18%	64.54%	NA
Indica II	465	3.70%	9.90%	0.43%	86.02%	NA
Indica III	913	0.50%	7.30%	0.55%	91.57%	NA
Indica Intermediate	786	2.90%	19.00%	0.25%	77.86%	NA
Temperate Japonica	767	66.10%	0.10%	4.56%	29.20%	NA
Tropical Japonica	504	86.10%	0.00%	0.00%	13.89%	NA
Japonica Intermediate	241	81.70%	0.40%	0.41%	17.43%	NA
VI/Aromatic	96	0.00%	3.10%	1.04%	95.83%	NA
Intermediate	90	36.70%	11.10%	0.00%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710776650	T -> DEL	N	N	silent_mutation	Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0710776650	T -> C	LOC_Os07g18170.1	upstream_gene_variant ; 3555.0bp to feature; MODIFIER	silent_mutation	Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0710776650	T -> C	LOC_Os07g18180.1	upstream_gene_variant ; 713.0bp to feature; MODIFIER	silent_mutation	Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0710776650	T -> C	LOC_Os07g18190.1	upstream_gene_variant ; 4120.0bp to feature; MODIFIER	silent_mutation	Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0710776650	T -> C	LOC_Os07g18180-LOC_Os07g18190	intergenic_region ; MODIFIER	silent_mutation	Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710776650	NA	6.31E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.46E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	5.51E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.87E-21	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	6.04E-19	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	2.54E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.75E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	3.61E-23	mr1167_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	5.02E-10	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	3.22E-07	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.66E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.15E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.27E-20	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	7.57E-09	mr1405_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.72E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	2.17E-08	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.96E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	5.93E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.39E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	7.04E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.55E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	6.77E-11	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.56E-19	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	6.90E-20	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	2.83E-11	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	5.16E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	7.08E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	1.42E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650	NA	2.06E-16	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251