\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710776650:

Variant ID: vg0710776650 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10776650
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.04, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTGTACTTATCAAATAAACAATATCTATATTAACTAATTTATATATGCACTTAAGCTGATGGCCCCATTATATAAATCATCGGATCTACTTTTTATTA[T/C]
ATTAGTCTATTATTCTCAAGTAATGGACTATTTCAAAATAAGGTCTACACCATTATATTGTGCATCCATTATATTAACAGTTTAAAATCTATATTAACTA

Reverse complement sequence

TAGTTAATATAGATTTTAAACTGTTAATATAATGGATGCACAATATAATGGTGTAGACCTTATTTTGAAATAGTCCATTACTTGAGAATAATAGACTAAT[A/G]
TAATAAAAAGTAGATCCGATGATTTATATAATGGGGCCATCAGCTTAAGTGCATATATAAATTAGTTAATATAGATATTGTTTATTTGATAAGTACACGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.80% 11.20% 1.16% 58.87% NA
All Indica  2759 2.10% 16.50% 0.58% 80.90% NA
All Japonica  1512 75.30% 0.10% 2.38% 22.22% NA
Aus  269 49.10% 22.30% 0.74% 27.88% NA
Indica I  595 2.00% 32.30% 1.18% 64.54% NA
Indica II  465 3.70% 9.90% 0.43% 86.02% NA
Indica III  913 0.50% 7.30% 0.55% 91.57% NA
Indica Intermediate  786 2.90% 19.00% 0.25% 77.86% NA
Temperate Japonica  767 66.10% 0.10% 4.56% 29.20% NA
Tropical Japonica  504 86.10% 0.00% 0.00% 13.89% NA
Japonica Intermediate  241 81.70% 0.40% 0.41% 17.43% NA
VI/Aromatic  96 0.00% 3.10% 1.04% 95.83% NA
Intermediate  90 36.70% 11.10% 0.00% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710776650 T -> DEL N N silent_mutation Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0710776650 T -> C LOC_Os07g18170.1 upstream_gene_variant ; 3555.0bp to feature; MODIFIER silent_mutation Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0710776650 T -> C LOC_Os07g18180.1 upstream_gene_variant ; 713.0bp to feature; MODIFIER silent_mutation Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0710776650 T -> C LOC_Os07g18190.1 upstream_gene_variant ; 4120.0bp to feature; MODIFIER silent_mutation Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0710776650 T -> C LOC_Os07g18180-LOC_Os07g18190 intergenic_region ; MODIFIER silent_mutation Average:16.845; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710776650 NA 6.31E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.46E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 5.51E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.87E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 6.04E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 2.54E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.75E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 3.61E-23 mr1167_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 5.02E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 3.22E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.66E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.15E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.27E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 7.57E-09 mr1405_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.72E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 2.17E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.96E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 5.93E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.39E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 7.04E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.55E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 6.77E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.56E-19 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 6.90E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 2.83E-11 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 5.16E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 7.08E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 1.42E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710776650 NA 2.06E-16 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251