\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710771920:

Variant ID: vg0710771920 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10771920
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATACACCGTTAGATAAAATTGATCTTAAAACAAACTAAATACCATGGGTCCCACCTATCCTCCTCCTGTGCATTGGCAGGTGGAGTATATACGTACGTA[G/C]
GTACACTACGCTAGTTCACGTCATCTCTGACGGGCCCATACTCTTACCTGTGACGGATAAAGCGTGTGGTCACAGACCAATGGTCACTGATGACATAAGT

Reverse complement sequence

ACTTATGTCATCAGTGACCATTGGTCTGTGACCACACGCTTTATCCGTCACAGGTAAGAGTATGGGCCCGTCAGAGATGACGTGAACTAGCGTAGTGTAC[C/G]
TACGTACGTATATACTCCACCTGCCAATGCACAGGAGGAGGATAGGTGGGACCCATGGTATTTAGTTTGTTTTAAGATCAATTTTATCTAACGGTGTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.70% 23.00% 23.25% 25.03% NA
All Indica  2759 1.90% 34.90% 35.19% 27.94% NA
All Japonica  1512 75.10% 3.60% 2.05% 19.31% NA
Aus  269 49.10% 15.60% 23.79% 11.52% NA
Indica I  595 1.20% 41.50% 28.57% 28.74% NA
Indica II  465 3.90% 27.70% 37.20% 31.18% NA
Indica III  913 0.20% 36.50% 41.73% 21.58% NA
Indica Intermediate  786 3.30% 32.40% 31.42% 32.82% NA
Temperate Japonica  767 65.70% 0.50% 1.17% 32.59% NA
Tropical Japonica  504 86.10% 9.50% 3.77% 0.60% NA
Japonica Intermediate  241 81.70% 0.80% 1.24% 16.18% NA
VI/Aromatic  96 1.00% 11.50% 14.58% 72.92% NA
Intermediate  90 37.80% 20.00% 21.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710771920 G -> DEL N N silent_mutation Average:33.517; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0710771920 G -> C LOC_Os07g18162.1 downstream_gene_variant ; 4787.0bp to feature; MODIFIER silent_mutation Average:33.517; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0710771920 G -> C LOC_Os07g18180.1 downstream_gene_variant ; 3451.0bp to feature; MODIFIER silent_mutation Average:33.517; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0710771920 G -> C LOC_Os07g18170.1 intron_variant ; MODIFIER silent_mutation Average:33.517; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710771920 NA 6.71E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 1.41E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 5.39E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 1.02E-07 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 4.13E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 8.51E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 8.79E-06 mr1239_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 6.92E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 8.23E-06 8.23E-06 mr1290_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 3.89E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 3.81E-06 3.81E-06 mr1365_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 3.80E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 2.34E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 2.34E-06 2.34E-06 mr1475_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 1.27E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 8.30E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 8.80E-07 8.80E-07 mr1643_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 1.02E-10 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 2.54E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 6.14E-07 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 4.61E-07 4.61E-07 mr1852_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 4.39E-06 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 1.12E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 2.71E-06 1.62E-08 mr1924_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 1.88E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 4.84E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 8.48E-06 1.74E-08 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 7.59E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 4.04E-06 4.04E-06 mr1967_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710771920 NA 2.99E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251