Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710656508:

Variant ID: vg0710656508 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10656508
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTGTGTTGATGTCGATTCTCCTCCACTTTATGGTTATTCTCTGCAAAAGGTTAGTATACCTAATACTAGTGGAATATTATTATTCTAACATATATATGC[G/A]
TTGCAAACATCACTAGTTCTCCTCAATTTCGGTAATATTGACGGTCGAAACTGATCGATAACGACCGTCAACATTGTTATGCCAAATACCTTCCCAATGG

Reverse complement sequence

CCATTGGGAAGGTATTTGGCATAACAATGTTGACGGTCGTTATCGATCAGTTTCGACCGTCAATATTACCGAAATTGAGGAGAACTAGTGATGTTTGCAA[C/T]
GCATATATATGTTAGAATAATAATATTCCACTAGTATTAGGTATACTAACCTTTTGCAGAGAATAACCATAAAGTGGAGGAGAATCGACATCAACACAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	32.30%	0.32%	3.00%	NA
All Indica	2759	96.30%	3.50%	0.18%	0.07%	NA
All Japonica	1512	10.60%	84.00%	0.53%	4.89%	NA
Aus	269	46.10%	49.10%	0.00%	4.83%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	89.70%	9.70%	0.51%	0.13%	NA
Temperate Japonica	767	1.70%	89.00%	0.26%	9.00%	NA
Tropical Japonica	504	27.60%	71.60%	0.40%	0.40%	NA
Japonica Intermediate	241	3.30%	93.80%	1.66%	1.24%	NA
VI/Aromatic	96	45.80%	2.10%	1.04%	51.04%	NA
Intermediate	90	65.60%	28.90%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710656508	G -> DEL	N	N	silent_mutation	Average:48.418; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0710656508	G -> A	LOC_Os07g18000.1	upstream_gene_variant ; 1770.0bp to feature; MODIFIER	silent_mutation	Average:48.418; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0710656508	G -> A	LOC_Os07g18010.1	upstream_gene_variant ; 526.0bp to feature; MODIFIER	silent_mutation	Average:48.418; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0710656508	G -> A	LOC_Os07g18000-LOC_Os07g18010	intergenic_region ; MODIFIER	silent_mutation	Average:48.418; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710656508	NA	7.82E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	3.73E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	2.84E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	4.00E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	3.56E-34	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.58E-37	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	2.33E-30	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.19E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	4.17E-40	mr1213	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	5.60E-12	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	2.03E-35	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.81E-40	mr1620	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	4.91E-10	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.47E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	9.43E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	4.13E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.57E-30	mr1102_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	4.25E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.21E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.80E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.04E-08	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	7.26E-35	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	2.16E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.23E-22	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	5.64E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	3.09E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.41E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	3.61E-15	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	4.28E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	7.23E-22	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	8.66E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.12E-07	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.53E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.78E-22	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	4.32E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	3.12E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710656508	NA	1.30E-11	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251