\
| Variant ID: vg0710603879 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10603879 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 82. )
CCATCCATGCTTTAAATTTAGAAAATTTTATTTCCCACATTTAACTTCACTTGTAAATTAAAGAACATTTAATATAAATTCTAATAATAATTTATTAAAT[G/A]
ATTTATAAATCCTGAAACAAAAATCAGGATGTGACAGATCTACCCCCCTTACAAAGAATCTCGTCCCGAGATTCGGAACGGCTAGAAAGAAAAAGGGAAT
ATTCCCTTTTTCTTTCTAGCCGTTCCGAATCTCGGGACGAGATTCTTTGTAAGGGGGGTAGATCTGTCACATCCTGATTTTTGTTTCAGGATTTATAAAT[C/T]
ATTTAATAAATTATTATTAGAATTTATATTAAATGTTCTTTAATTTACAAGTGAAGTTAAATGTGGGAAATAAAATTTTCTAAATTTAAAGCATGGATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.40% | 0.80% | 5.99% | 58.78% | NA |
| All Indica | 2759 | 4.40% | 0.60% | 5.00% | 90.00% | NA |
| All Japonica | 1512 | 88.10% | 0.10% | 1.06% | 10.78% | NA |
| Aus | 269 | 49.80% | 5.60% | 18.59% | 26.02% | NA |
| Indica I | 595 | 1.70% | 0.20% | 1.85% | 96.30% | NA |
| Indica II | 465 | 4.30% | 0.20% | 3.01% | 92.47% | NA |
| Indica III | 913 | 1.00% | 1.10% | 8.87% | 89.05% | NA |
| Indica Intermediate | 786 | 10.40% | 0.60% | 4.07% | 84.86% | NA |
| Temperate Japonica | 767 | 86.60% | 0.00% | 0.78% | 12.65% | NA |
| Tropical Japonica | 504 | 86.50% | 0.20% | 1.19% | 12.10% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 1.66% | 2.07% | NA |
| VI/Aromatic | 96 | 5.20% | 5.20% | 73.96% | 15.62% | NA |
| Intermediate | 90 | 37.80% | 1.10% | 8.89% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710603879 | G -> DEL | N | N | silent_mutation | Average:10.705; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0710603879 | G -> A | LOC_Os07g17910.1 | upstream_gene_variant ; 3776.0bp to feature; MODIFIER | silent_mutation | Average:10.705; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0710603879 | G -> A | LOC_Os07g17930.1 | upstream_gene_variant ; 4099.0bp to feature; MODIFIER | silent_mutation | Average:10.705; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0710603879 | G -> A | LOC_Os07g17920.1 | downstream_gene_variant ; 481.0bp to feature; MODIFIER | silent_mutation | Average:10.705; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0710603879 | G -> A | LOC_Os07g17910-LOC_Os07g17920 | intergenic_region ; MODIFIER | silent_mutation | Average:10.705; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710603879 | NA | 3.26E-26 | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 1.66E-32 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 4.95E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 2.10E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 2.67E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | 5.85E-07 | 8.25E-07 | mr1698 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 1.22E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 7.65E-39 | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 6.83E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 1.42E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 1.97E-21 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 3.52E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 2.04E-25 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 5.38E-20 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 5.95E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 1.18E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 1.86E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710603879 | NA | 7.29E-14 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |