Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0710590918:

Variant ID: vg0710590918 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10590918
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TGAACTATAATTATAATTATATGAGGTGAAGATTTATAACTAGTATTTATCTAATATACATGTTTGTCATACACTCCCTCTAAATTAATATATGCAACAC[G/A]
CAAATTAATACTATACCGTACAACTATAATGGGATGTATAGTATATGTGTAAGCAACAATATTTTATTATTAGATCATATATTTGAGTATTTGCTTTTTA

Reverse complement sequence

TAAAAAGCAAATACTCAAATATATGATCTAATAATAAAATATTGTTGCTTACACATATACTATACATCCCATTATAGTTGTACGGTATAGTATTAATTTG[C/T]
GTGTTGCATATATTAATTTAGAGGGAGTGTATGACAAACATGTATATTAGATAAATACTAGTTATAAATCTTCACCTCATATAATTATAATTATAGTTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	38.60%	1.84%	0.25%	NA
All Indica	2759	91.50%	5.70%	2.39%	0.36%	NA
All Japonica	1512	6.70%	92.90%	0.46%	0.00%	NA
Aus	269	40.10%	55.00%	4.09%	0.74%	NA
Indica I	595	95.80%	2.00%	2.18%	0.00%	NA
Indica II	465	90.50%	4.70%	3.66%	1.08%	NA
Indica III	913	94.60%	3.10%	1.97%	0.33%	NA
Indica Intermediate	786	85.20%	12.20%	2.29%	0.25%	NA
Temperate Japonica	767	3.80%	95.30%	0.91%	0.00%	NA
Tropical Japonica	504	13.30%	86.70%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	54.40%	42.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710590918	G -> DEL	N	N	silent_mutation	Average:16.752; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg0710590918	G -> A	LOC_Os07g17900.1	upstream_gene_variant ; 1450.0bp to feature; MODIFIER	silent_mutation	Average:16.752; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg0710590918	G -> A	LOC_Os07g17910.1	downstream_gene_variant ; 3458.0bp to feature; MODIFIER	silent_mutation	Average:16.752; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg0710590918	G -> A	LOC_Os07g17890-LOC_Os07g17900	intergenic_region ; MODIFIER	silent_mutation	Average:16.752; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710590918	NA	7.70E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710590918	NA	1.66E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710590918	7.81E-06	NA	mr1904	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251