\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710572692:

Variant ID: vg0710572692 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10572692
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATCTCCTCCACCTCAGCAAAGCCAGAGGTTGGTGACGATCAGCAAGAAGTAAGTAAACGTTCTTGAGGTCTTTTCATTCTCGAAGTTTTGATTGTCTA[C/G]
CGTCATGAAGTAAAGGAAAATCTTCGCAGAATGGCGCAGGCGAAGGTGGCGCAAGGTGGGACTGATGCTGCTTCCAGCGTGTCCCCTGTGGCGACTTCGA

Reverse complement sequence

TCGAAGTCGCCACAGGGGACACGCTGGAAGCAGCATCAGTCCCACCTTGCGCCACCTTCGCCTGCGCCATTCTGCGAAGATTTTCCTTTACTTCATGACG[G/C]
TAGACAATCAAAACTTCGAGAATGAAAAGACCTCAAGAACGTTTACTTACTTCTTGCTGATCGTCACCAACCTCTGGCTTTGCTGAGGTGGAGGAGATGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 35.40% 0.08% 0.61% NA
All Indica  2759 96.00% 3.70% 0.04% 0.25% NA
All Japonica  1512 6.30% 93.20% 0.00% 0.46% NA
Aus  269 50.60% 49.10% 0.00% 0.37% NA
Indica I  595 98.50% 1.00% 0.00% 0.50% NA
Indica II  465 95.90% 3.70% 0.22% 0.22% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 89.90% 9.80% 0.00% 0.25% NA
Temperate Japonica  767 2.30% 96.90% 0.00% 0.78% NA
Tropical Japonica  504 13.70% 86.10% 0.00% 0.20% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 1.00% 0.00% 11.46% NA
Intermediate  90 58.90% 34.40% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710572692 C -> DEL N N silent_mutation Average:65.857; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 N N N N
vg0710572692 C -> G LOC_Os07g17870.1 upstream_gene_variant ; 3932.0bp to feature; MODIFIER silent_mutation Average:65.857; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 N N N N
vg0710572692 C -> G LOC_Os07g17860.1 intron_variant ; MODIFIER silent_mutation Average:65.857; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710572692 NA 5.51E-07 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 3.54E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 4.19E-06 mr1245 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 3.12E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 7.75E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 3.50E-06 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 2.33E-06 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 7.72E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 3.07E-07 4.49E-07 mr1573 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 7.36E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 2.09E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 2.43E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 2.33E-07 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 5.50E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 9.48E-06 2.47E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 1.74E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 2.33E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 1.25E-07 1.25E-07 mr1976 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 9.85E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 4.34E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710572692 NA 6.95E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251