\
| Variant ID: vg0710554467 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10554467 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTAACTGCAGTATAATAATTCATTTTATTAGTCAAAAATAAAATGATTTCAAATGAAAAATTGTCAACAACAAAGTTGTATAACTTATCAAAATTTACAA[G/T]
TTTTATTTTGGTCATTTTTCTATATAACTTTTTTGAACAATTTAAATTTGAATTAGAAAATATGACAACTTCAAACAATATTTTCAAATATTAAATGATT
AATCATTTAATATTTGAAAATATTGTTTGAAGTTGTCATATTTTCTAATTCAAATTTAAATTGTTCAAAAAAGTTATATAGAAAAATGACCAAAATAAAA[C/A]
TTGTAAATTTTGATAAGTTATACAACTTTGTTGTTGACAATTTTTCATTTGAAATCATTTTATTTTTGACTAATAAAATGAATTATTATACTGCAGTTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 34.00% | 0.53% | 1.33% | NA |
| All Indica | 2759 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 6.20% | 88.20% | 1.52% | 4.17% | NA |
| Aus | 269 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 86.80% | 3.00% | 8.21% | NA |
| Tropical Japonica | 504 | 13.70% | 86.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 34.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710554467 | G -> DEL | N | N | silent_mutation | Average:17.829; most accessible tissue: Callus, score: 31.5 | N | N | N | N |
| vg0710554467 | G -> T | LOC_Os07g17840.1 | upstream_gene_variant ; 580.0bp to feature; MODIFIER | silent_mutation | Average:17.829; most accessible tissue: Callus, score: 31.5 | N | N | N | N |
| vg0710554467 | G -> T | LOC_Os07g17840-LOC_Os07g17850 | intergenic_region ; MODIFIER | silent_mutation | Average:17.829; most accessible tissue: Callus, score: 31.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710554467 | NA | 7.28E-08 | mr1028 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 5.66E-14 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | 1.95E-06 | 1.95E-06 | mr1369 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 7.65E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 1.31E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 1.17E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 1.38E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 3.25E-08 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 2.10E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 1.65E-07 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 3.87E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710554467 | NA | 1.87E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |