| Variant ID: vg0710495043 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10495043 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGCGTTTCGGCGAGGGGAGGCAGCAACCGAGGGGCGGACGGTCTTCACCTCGCTCCTGCGATCCCGAGGGTAGCGACGGCGAGCGAAGGCGGCGATGGAC[G/C,A]
GCGACGAGCGGCACGGCTGAAAACGAGTCGACGGAAGATTGCCTCGGGTTGACAGCGACGACGAAGCTCCGATGGTTTGCAGCGGTGGCGAAGGGGTGGA
TCCACCCCTTCGCCACCGCTGCAAACCATCGGAGCTTCGTCGTCGCTGTCAACCCGAGGCAATCTTCCGTCGACTCGTTTTCAGCCGTGCCGCTCGTCGC[C/G,T]
GTCCATCGCCGCCTTCGCTCGCCGTCGCTACCCTCGGGATCGCAGGAGCGAGGTGAAGACCGTCCGCCCCTCGGTTGCTGCCTCCCCTCGCCGAAACGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 3.60% | 0.97% | 3.62% | A: 0.32% |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | A: 0.04% |
| All Japonica | 1512 | 79.70% | 11.20% | 1.12% | 7.87% | A: 0.13% |
| Aus | 269 | 82.90% | 0.00% | 1.12% | 15.61% | A: 0.37% |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.00% | A: 0.11% |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 74.10% | 17.60% | 1.83% | 6.52% | NA |
| Tropical Japonica | 504 | 85.50% | 0.20% | 0.20% | 13.69% | A: 0.40% |
| Japonica Intermediate | 241 | 85.50% | 13.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 1.00% | 20.83% | 9.38% | A: 9.38% |
| Intermediate | 90 | 92.20% | 0.00% | 4.44% | 1.11% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710495043 | G -> DEL | N | N | silent_mutation | Average:51.663; most accessible tissue: Callus, score: 93.013 | N | N | N | N |
| vg0710495043 | G -> A | LOC_Os07g17760.1 | upstream_gene_variant ; 2499.0bp to feature; MODIFIER | silent_mutation | Average:51.663; most accessible tissue: Callus, score: 93.013 | N | N | N | N |
| vg0710495043 | G -> A | LOC_Os07g17770.1 | upstream_gene_variant ; 4722.0bp to feature; MODIFIER | silent_mutation | Average:51.663; most accessible tissue: Callus, score: 93.013 | N | N | N | N |
| vg0710495043 | G -> A | LOC_Os07g17760-LOC_Os07g17770 | intergenic_region ; MODIFIER | silent_mutation | Average:51.663; most accessible tissue: Callus, score: 93.013 | N | N | N | N |
| vg0710495043 | G -> C | LOC_Os07g17760.1 | upstream_gene_variant ; 2499.0bp to feature; MODIFIER | silent_mutation | Average:51.663; most accessible tissue: Callus, score: 93.013 | N | N | N | N |
| vg0710495043 | G -> C | LOC_Os07g17770.1 | upstream_gene_variant ; 4722.0bp to feature; MODIFIER | silent_mutation | Average:51.663; most accessible tissue: Callus, score: 93.013 | N | N | N | N |
| vg0710495043 | G -> C | LOC_Os07g17760-LOC_Os07g17770 | intergenic_region ; MODIFIER | silent_mutation | Average:51.663; most accessible tissue: Callus, score: 93.013 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710495043 | NA | 4.08E-09 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0710495043 | NA | 3.11E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710495043 | NA | 1.06E-09 | mr1624 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710495043 | NA | 9.77E-06 | mr1677 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710495043 | NA | 8.95E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/