Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710469439:

Variant ID: vg0710469439 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10469439
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTTCACTACCGGCTATAGTCATCGCTGCCGACTGGTGTTTTCGTCACCATTGATGGACGATTTTGTTTCCACATCGGTCACCTTTATCGTCACCGAGG[A/G]
AAATATCAAAAAGCTAAGTCATCACTAATTTTCTTTTTTTATATGATATTTTCCTTTTCCTCTGCCTCACTACGTCAACTGGTTCGCCGTTGCCTAGTGA

Reverse complement sequence

TCACTAGGCAACGGCGAACCAGTTGACGTAGTGAGGCAGAGGAAAAGGAAAATATCATATAAAAAAAGAAAATTAGTGATGACTTAGCTTTTTGATATTT[T/C]
CCTCGGTGACGATAAAGGTGACCGATGTGGAAACAAAATCGTCCATCAATGGTGACGAAAACACCAGTCGGCAGCGATGACTATAGCCGGTAGTGAAGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.00%	29.90%	1.02%	2.07%	NA
All Indica	2759	96.70%	2.10%	1.12%	0.07%	NA
All Japonica	1512	19.90%	76.20%	0.00%	3.90%	NA
Aus	269	46.10%	52.40%	0.74%	0.74%	NA
Indica I	595	96.50%	1.00%	2.52%	0.00%	NA
Indica II	465	96.30%	3.40%	0.22%	0.00%	NA
Indica III	913	97.70%	1.00%	1.20%	0.11%	NA
Indica Intermediate	786	95.80%	3.60%	0.51%	0.13%	NA
Temperate Japonica	767	33.50%	59.10%	0.00%	7.43%	NA
Tropical Japonica	504	0.80%	99.00%	0.00%	0.20%	NA
Japonica Intermediate	241	16.60%	83.00%	0.00%	0.41%	NA
VI/Aromatic	96	25.00%	27.10%	13.54%	34.38%	NA
Intermediate	90	54.40%	41.10%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710469439	A -> DEL	N	N	silent_mutation	Average:57.236; most accessible tissue: Zhenshan97 flag leaf, score: 80.588	N	N	N	N
vg0710469439	A -> G	LOC_Os07g17720.1	upstream_gene_variant ; 1830.0bp to feature; MODIFIER	silent_mutation	Average:57.236; most accessible tissue: Zhenshan97 flag leaf, score: 80.588	N	N	N	N
vg0710469439	A -> G	LOC_Os07g17730.1	downstream_gene_variant ; 1268.0bp to feature; MODIFIER	silent_mutation	Average:57.236; most accessible tissue: Zhenshan97 flag leaf, score: 80.588	N	N	N	N
vg0710469439	A -> G	LOC_Os07g17720-LOC_Os07g17730	intergenic_region ; MODIFIER	silent_mutation	Average:57.236; most accessible tissue: Zhenshan97 flag leaf, score: 80.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710469439	NA	9.99E-17	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	6.27E-07	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	4.65E-18	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	2.43E-15	mr1626	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	4.37E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	9.66E-10	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	1.32E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	3.35E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	1.07E-19	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	2.90E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	2.86E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	8.21E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	8.00E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	1.18E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	8.34E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	4.81E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439	NA	1.01E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251