\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710469439:

Variant ID: vg0710469439 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10469439
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCTTCACTACCGGCTATAGTCATCGCTGCCGACTGGTGTTTTCGTCACCATTGATGGACGATTTTGTTTCCACATCGGTCACCTTTATCGTCACCGAGG[A/G]
AAATATCAAAAAGCTAAGTCATCACTAATTTTCTTTTTTTATATGATATTTTCCTTTTCCTCTGCCTCACTACGTCAACTGGTTCGCCGTTGCCTAGTGA

Reverse complement sequence

TCACTAGGCAACGGCGAACCAGTTGACGTAGTGAGGCAGAGGAAAAGGAAAATATCATATAAAAAAAGAAAATTAGTGATGACTTAGCTTTTTGATATTT[T/C]
CCTCGGTGACGATAAAGGTGACCGATGTGGAAACAAAATCGTCCATCAATGGTGACGAAAACACCAGTCGGCAGCGATGACTATAGCCGGTAGTGAAGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 29.90% 1.02% 2.07% NA
All Indica  2759 96.70% 2.10% 1.12% 0.07% NA
All Japonica  1512 19.90% 76.20% 0.00% 3.90% NA
Aus  269 46.10% 52.40% 0.74% 0.74% NA
Indica I  595 96.50% 1.00% 2.52% 0.00% NA
Indica II  465 96.30% 3.40% 0.22% 0.00% NA
Indica III  913 97.70% 1.00% 1.20% 0.11% NA
Indica Intermediate  786 95.80% 3.60% 0.51% 0.13% NA
Temperate Japonica  767 33.50% 59.10% 0.00% 7.43% NA
Tropical Japonica  504 0.80% 99.00% 0.00% 0.20% NA
Japonica Intermediate  241 16.60% 83.00% 0.00% 0.41% NA
VI/Aromatic  96 25.00% 27.10% 13.54% 34.38% NA
Intermediate  90 54.40% 41.10% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710469439 A -> DEL N N silent_mutation Average:57.236; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N
vg0710469439 A -> G LOC_Os07g17720.1 upstream_gene_variant ; 1830.0bp to feature; MODIFIER silent_mutation Average:57.236; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N
vg0710469439 A -> G LOC_Os07g17730.1 downstream_gene_variant ; 1268.0bp to feature; MODIFIER silent_mutation Average:57.236; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N
vg0710469439 A -> G LOC_Os07g17720-LOC_Os07g17730 intergenic_region ; MODIFIER silent_mutation Average:57.236; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710469439 NA 9.99E-17 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 6.27E-07 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 4.65E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 2.43E-15 mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 4.37E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 9.66E-10 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 1.32E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 3.35E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 1.07E-19 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 2.90E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 2.86E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 8.21E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 8.00E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 1.18E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 8.34E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 4.81E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710469439 NA 1.01E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251