\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710453528:

Variant ID: vg0710453528 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10453528
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTCGCCTCCGCGTCGCCAAGCGTTGCGCCGGCCGCGTCTCGCCTTCATGCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGTTCGCCTCCGTCGTCCC[C/T]
GAGCCGTCTCCGCCACGCTCGTTCATCGTTGTCGTTCCCACGCCTCGTCGCGTGGTGGTAAGGATCCGTCCTCTCGCTGCCCCGTCCTAGTCCTTTCGGT

Reverse complement sequence

ACCGAAAGGACTAGGACGGGGCAGCGAGAGGACGGATCCTTACCACCACGCGACGAGGCGTGGGAACGACAACGATGAACGAGCGTGGCGGAGACGGCTC[G/A]
GGGACGACGGAGGCGAACGGCGAGGGAACGACTTCGGCGGCGATCCTTGCATGAAGGCGAGACGCGGCCGGCGCAACGCTTGGCGACGCGGAGGCGAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 9.70% 0.85% 0.42% NA
All Indica  2759 99.30% 0.40% 0.25% 0.00% NA
All Japonica  1512 79.20% 20.50% 0.13% 0.13% NA
Aus  269 51.70% 46.50% 1.49% 0.37% NA
Indica I  595 99.00% 0.20% 0.84% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.10% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 39.90% 59.70% 0.20% 0.20% NA
Japonica Intermediate  241 95.40% 3.70% 0.41% 0.41% NA
VI/Aromatic  96 56.20% 2.10% 27.08% 14.58% NA
Intermediate  90 86.70% 8.90% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710453528 C -> DEL N N silent_mutation Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0710453528 C -> T LOC_Os07g17700.1 downstream_gene_variant ; 1574.0bp to feature; MODIFIER silent_mutation Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0710453528 C -> T LOC_Os07g17710.1 downstream_gene_variant ; 4692.0bp to feature; MODIFIER silent_mutation Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0710453528 C -> T LOC_Os07g17700-LOC_Os07g17710 intergenic_region ; MODIFIER silent_mutation Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710453528 NA 9.05E-06 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 4.24E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 7.32E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 2.75E-09 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 2.28E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 1.92E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 8.48E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 5.20E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 1.29E-07 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 2.95E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 4.53E-09 mr1277_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 7.73E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 7.03E-13 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 1.96E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 8.60E-06 mr1378_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 4.29E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 9.22E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528 NA 2.57E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251