\
| Variant ID: vg0710453528 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10453528 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCTCGCCTCCGCGTCGCCAAGCGTTGCGCCGGCCGCGTCTCGCCTTCATGCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGTTCGCCTCCGTCGTCCC[C/T]
GAGCCGTCTCCGCCACGCTCGTTCATCGTTGTCGTTCCCACGCCTCGTCGCGTGGTGGTAAGGATCCGTCCTCTCGCTGCCCCGTCCTAGTCCTTTCGGT
ACCGAAAGGACTAGGACGGGGCAGCGAGAGGACGGATCCTTACCACCACGCGACGAGGCGTGGGAACGACAACGATGAACGAGCGTGGCGGAGACGGCTC[G/A]
GGGACGACGGAGGCGAACGGCGAGGGAACGACTTCGGCGGCGATCCTTGCATGAAGGCGAGACGCGGCCGGCGCAACGCTTGGCGACGCGGAGGCGAGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 9.70% | 0.85% | 0.42% | NA |
| All Indica | 2759 | 99.30% | 0.40% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 79.20% | 20.50% | 0.13% | 0.13% | NA |
| Aus | 269 | 51.70% | 46.50% | 1.49% | 0.37% | NA |
| Indica I | 595 | 99.00% | 0.20% | 0.84% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.90% | 59.70% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 56.20% | 2.10% | 27.08% | 14.58% | NA |
| Intermediate | 90 | 86.70% | 8.90% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710453528 | C -> DEL | N | N | silent_mutation | Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0710453528 | C -> T | LOC_Os07g17700.1 | downstream_gene_variant ; 1574.0bp to feature; MODIFIER | silent_mutation | Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0710453528 | C -> T | LOC_Os07g17710.1 | downstream_gene_variant ; 4692.0bp to feature; MODIFIER | silent_mutation | Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0710453528 | C -> T | LOC_Os07g17700-LOC_Os07g17710 | intergenic_region ; MODIFIER | silent_mutation | Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710453528 | NA | 9.05E-06 | mr1266 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 4.24E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 7.32E-07 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 2.75E-09 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 2.28E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 1.92E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 8.48E-10 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 5.20E-08 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 1.29E-07 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 2.95E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 4.53E-09 | mr1277_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 7.73E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 7.03E-13 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 1.96E-08 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 8.60E-06 | mr1378_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 4.29E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 9.22E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710453528 | NA | 2.57E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |