\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710432728:

Variant ID: vg0710432728 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10432728
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.30, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGAGCAGGCTCAGGTTTTGAACATAAAACCAATTTGCATGCCAGCCTTTGTTTGAGGTTTTGAAGGGCATAGAGAAGTATTTTTGGCTTAGGGTTCCC[C/T]
TAAGTTGGAAATCAGCACCCCCAACGACGCATGGTTTGTTCTTGTTTGGCTGGGGCTTGAGGAAGAAGATGCGGCGGAACAAGGCGAAATGAGGCCTAAT

Reverse complement sequence

ATTAGGCCTCATTTCGCCTTGTTCCGCCGCATCTTCTTCCTCAAGCCCCAGCCAAACAAGAACAAACCATGCGTCGTTGGGGGTGCTGATTTCCAACTTA[G/A]
GGGAACCCTAAGCCAAAAATACTTCTCTATGCCCTTCAAAACCTCAAACAAAGGCTGGCATGCAAATTGGTTTTATGTTCAAAACCTGAGCCTGCTCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 1.80% 19.23% 39.53% NA
All Indica  2759 7.20% 2.50% 25.30% 64.91% NA
All Japonica  1512 94.40% 0.10% 4.76% 0.73% NA
Aus  269 55.40% 3.30% 27.51% 13.75% NA
Indica I  595 6.70% 1.50% 40.17% 51.60% NA
Indica II  465 7.10% 2.20% 27.74% 63.01% NA
Indica III  913 2.80% 3.30% 12.05% 81.82% NA
Indica Intermediate  786 12.80% 2.70% 27.99% 56.49% NA
Temperate Japonica  767 98.30% 0.00% 1.30% 0.39% NA
Tropical Japonica  504 86.70% 0.00% 12.10% 1.19% NA
Japonica Intermediate  241 98.30% 0.40% 0.41% 0.83% NA
VI/Aromatic  96 49.00% 2.10% 43.75% 5.21% NA
Intermediate  90 46.70% 1.10% 25.56% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710432728 C -> DEL N N silent_mutation Average:28.706; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0710432728 C -> T LOC_Os07g17660.1 upstream_gene_variant ; 933.0bp to feature; MODIFIER silent_mutation Average:28.706; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0710432728 C -> T LOC_Os07g17680.1 upstream_gene_variant ; 1959.0bp to feature; MODIFIER silent_mutation Average:28.706; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0710432728 C -> T LOC_Os07g17670.1 intron_variant ; MODIFIER silent_mutation Average:28.706; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710432728 NA 6.47E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 2.01E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 1.62E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 1.36E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 7.91E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 1.53E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 4.81E-06 4.81E-06 mr1209_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 7.51E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 1.23E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 2.42E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 2.59E-08 mr1376_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 4.72E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 2.18E-08 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 2.23E-06 mr1447_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 9.53E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 1.70E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 5.54E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 3.55E-07 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 4.25E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 2.68E-06 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 2.85E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 4.51E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 4.33E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 7.55E-06 mr1938_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 2.05E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728 NA 5.40E-07 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251