Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710432728:

Variant ID: vg0710432728 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10432728
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.30, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGAGCAGGCTCAGGTTTTGAACATAAAACCAATTTGCATGCCAGCCTTTGTTTGAGGTTTTGAAGGGCATAGAGAAGTATTTTTGGCTTAGGGTTCCC[C/T]
TAAGTTGGAAATCAGCACCCCCAACGACGCATGGTTTGTTCTTGTTTGGCTGGGGCTTGAGGAAGAAGATGCGGCGGAACAAGGCGAAATGAGGCCTAAT

Reverse complement sequence

ATTAGGCCTCATTTCGCCTTGTTCCGCCGCATCTTCTTCCTCAAGCCCCAGCCAAACAAGAACAAACCATGCGTCGTTGGGGGTGCTGATTTCCAACTTA[G/A]
GGGAACCCTAAGCCAAAAATACTTCTCTATGCCCTTCAAAACCTCAAACAAAGGCTGGCATGCAAATTGGTTTTATGTTCAAAACCTGAGCCTGCTCTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.50%	1.80%	19.23%	39.53%	NA
All Indica	2759	7.20%	2.50%	25.30%	64.91%	NA
All Japonica	1512	94.40%	0.10%	4.76%	0.73%	NA
Aus	269	55.40%	3.30%	27.51%	13.75%	NA
Indica I	595	6.70%	1.50%	40.17%	51.60%	NA
Indica II	465	7.10%	2.20%	27.74%	63.01%	NA
Indica III	913	2.80%	3.30%	12.05%	81.82%	NA
Indica Intermediate	786	12.80%	2.70%	27.99%	56.49%	NA
Temperate Japonica	767	98.30%	0.00%	1.30%	0.39%	NA
Tropical Japonica	504	86.70%	0.00%	12.10%	1.19%	NA
Japonica Intermediate	241	98.30%	0.40%	0.41%	0.83%	NA
VI/Aromatic	96	49.00%	2.10%	43.75%	5.21%	NA
Intermediate	90	46.70%	1.10%	25.56%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710432728	C -> DEL	N	N	silent_mutation	Average:28.706; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0710432728	C -> T	LOC_Os07g17660.1	upstream_gene_variant ; 933.0bp to feature; MODIFIER	silent_mutation	Average:28.706; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0710432728	C -> T	LOC_Os07g17680.1	upstream_gene_variant ; 1959.0bp to feature; MODIFIER	silent_mutation	Average:28.706; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0710432728	C -> T	LOC_Os07g17670.1	intron_variant ; MODIFIER	silent_mutation	Average:28.706; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710432728	NA	6.47E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	2.01E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	1.62E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	1.36E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	7.91E-06	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	1.53E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	4.81E-06	4.81E-06	mr1209_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	7.51E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	1.23E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	2.42E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	2.59E-08	mr1376_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	4.72E-09	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	2.18E-08	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	2.23E-06	mr1447_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	9.53E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	1.70E-07	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	5.54E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	3.55E-07	mr1743_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	4.25E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	2.68E-06	mr1906_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	2.85E-06	mr1909_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	4.51E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	4.33E-06	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	7.55E-06	mr1938_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	2.05E-07	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710432728	NA	5.40E-07	mr1960_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251