\
| Variant ID: vg0710415797 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10415797 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATCAAGCAGGCCGTCACATGTGACAAAGAAAGTTGCGAGATGGCCCAAACCCACGAGACTACTCTTGCCCGCGAAGAGATCCGACTGGCTGCGACCACG[G/A]
CAAGCGAGGGAGAAGTGCCTGCAACCAAGCTGACGAAGACCGAAGAAGGTGATGCCAAGATGAAAAAGATTCCCTTAGATCCCTCCGATCCTGATAAGAC
GTCTTATCAGGATCGGAGGGATCTAAGGGAATCTTTTTCATCTTGGCATCACCTTCTTCGGTCTTCGTCAGCTTGGTTGCAGGCACTTCTCCCTCGCTTG[C/T]
CGTGGTCGCAGCCAGTCGGATCTCTTCGCGGGCAAGAGTAGTCTCGTGGGTTTGGGCCATCTCGCAACTTTCTTTGTCACATGTGACGGCCTGCTTGATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.50% | 1.60% | 1.74% | 0.17% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 91.50% | 4.60% | 3.70% | 0.13% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 83.80% | 9.10% | 7.04% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 0.00% | 26.04% | 6.25% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710415797 | G -> DEL | LOC_Os07g17630.1 | N | frameshift_variant | Average:20.007; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| vg0710415797 | G -> A | LOC_Os07g17630.1 | missense_variant ; p.Ala307Thr; MODERATE | nonsynonymous_codon ; A307T | Average:20.007; most accessible tissue: Zhenshan97 root, score: 34.536 | benign |
0.383 |
TOLERATED | 0.12 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710415797 | NA | 2.98E-08 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710415797 | 2.37E-07 | 2.37E-07 | mr1369 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710415797 | NA | 1.72E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710415797 | NA | 2.19E-06 | mr1616 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710415797 | NA | 1.66E-08 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710415797 | NA | 1.97E-08 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710415797 | NA | 2.35E-08 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710415797 | NA | 8.42E-06 | mr1358_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |