\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710415797:

Variant ID: vg0710415797 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10415797
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCAAGCAGGCCGTCACATGTGACAAAGAAAGTTGCGAGATGGCCCAAACCCACGAGACTACTCTTGCCCGCGAAGAGATCCGACTGGCTGCGACCACG[G/A]
CAAGCGAGGGAGAAGTGCCTGCAACCAAGCTGACGAAGACCGAAGAAGGTGATGCCAAGATGAAAAAGATTCCCTTAGATCCCTCCGATCCTGATAAGAC

Reverse complement sequence

GTCTTATCAGGATCGGAGGGATCTAAGGGAATCTTTTTCATCTTGGCATCACCTTCTTCGGTCTTCGTCAGCTTGGTTGCAGGCACTTCTCCCTCGCTTG[C/T]
CGTGGTCGCAGCCAGTCGGATCTCTTCGCGGGCAAGAGTAGTCTCGTGGGTTTGGGCCATCTCGCAACTTTCTTTGTCACATGTGACGGCCTGCTTGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 1.60% 1.74% 0.17% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 91.50% 4.60% 3.70% 0.13% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 83.80% 9.10% 7.04% 0.00% NA
Tropical Japonica  504 99.20% 0.00% 0.40% 0.40% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 0.00% 26.04% 6.25% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710415797 G -> DEL LOC_Os07g17630.1 N frameshift_variant Average:20.007; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0710415797 G -> A LOC_Os07g17630.1 missense_variant ; p.Ala307Thr; MODERATE nonsynonymous_codon ; A307T Average:20.007; most accessible tissue: Zhenshan97 root, score: 34.536 benign 0.383 TOLERATED 0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710415797 NA 2.98E-08 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710415797 2.37E-07 2.37E-07 mr1369 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710415797 NA 1.72E-07 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710415797 NA 2.19E-06 mr1616 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710415797 NA 1.66E-08 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710415797 NA 1.97E-08 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710415797 NA 2.35E-08 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710415797 NA 8.42E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251