\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710393345:

Variant ID: vg0710393345 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10393345
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.16, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


AACAGATTGCAAAGGAGGCTGAAGATCGACGACAACGCGCCTTGCAATCTGGGCGGCGAGTGAGAGAGCTCATTGGGCAACAAGACATCGATGGGACAGC[G/A]
GTCTTTCGCACCCCCCCAGCAGAACGCGGTTGTAGCAATCACTCTCCTCGACACCCTCCTCAAGGAAGACGCACTCAACCAAGCCGATCATGTTGTCAAC

Reverse complement sequence

GTTGACAACATGATCGGCTTGGTTGAGTGCGTCTTCCTTGAGGAGGGTGTCGAGGAGAGTGATTGCTACAACCGCGTTCTGCTGGGGGGGTGCGAAAGAC[C/T]
GCTGTCCCATCGATGTCTTGTTGCCCAATGAGCTCTCTCACTCGCCGCCCAGATTGCAAGGCGCGTTGTCGTCGATCTTCAGCCTCCTTTGCAATCTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 0.40% 2.54% 57.45% NA
All Indica  2759 8.40% 0.70% 2.72% 88.15% NA
All Japonica  1512 94.70% 0.00% 0.66% 4.63% NA
Aus  269 56.90% 0.00% 8.92% 34.20% NA
Indica I  595 10.60% 0.50% 1.34% 87.56% NA
Indica II  465 7.10% 0.20% 0.65% 92.04% NA
Indica III  913 4.30% 1.10% 2.52% 92.11% NA
Indica Intermediate  786 12.30% 0.80% 5.22% 81.68% NA
Temperate Japonica  767 97.00% 0.00% 1.04% 1.96% NA
Tropical Japonica  504 90.10% 0.00% 0.40% 9.52% NA
Japonica Intermediate  241 97.10% 0.00% 0.00% 2.90% NA
VI/Aromatic  96 12.50% 0.00% 6.25% 81.25% NA
Intermediate  90 46.70% 0.00% 5.56% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710393345 G -> DEL N N silent_mutation Average:17.787; most accessible tissue: Zhenshan97 young leaf, score: 26.435 N N N N
vg0710393345 G -> A LOC_Os07g17590.1 upstream_gene_variant ; 3653.0bp to feature; MODIFIER silent_mutation Average:17.787; most accessible tissue: Zhenshan97 young leaf, score: 26.435 N N N N
vg0710393345 G -> A LOC_Os07g17610.1 upstream_gene_variant ; 3067.0bp to feature; MODIFIER silent_mutation Average:17.787; most accessible tissue: Zhenshan97 young leaf, score: 26.435 N N N N
vg0710393345 G -> A LOC_Os07g17600.1 downstream_gene_variant ; 38.0bp to feature; MODIFIER silent_mutation Average:17.787; most accessible tissue: Zhenshan97 young leaf, score: 26.435 N N N N
vg0710393345 G -> A LOC_Os07g17600-LOC_Os07g17610 intergenic_region ; MODIFIER silent_mutation Average:17.787; most accessible tissue: Zhenshan97 young leaf, score: 26.435 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710393345 3.79E-06 1.60E-07 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 5.25E-06 5.24E-06 mr1048_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 4.20E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 8.34E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 2.82E-06 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 4.69E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 1.30E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 9.12E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 7.37E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 6.23E-06 6.23E-06 mr1357_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 8.75E-07 8.75E-07 mr1365_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 6.12E-06 mr1366_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 8.42E-07 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 5.56E-06 1.63E-07 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 1.19E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 8.12E-07 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 1.73E-06 1.73E-06 mr1459_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 4.06E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 5.16E-06 5.16E-06 mr1475_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 7.40E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 2.87E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 5.28E-06 mr1594_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 1.46E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 6.35E-07 6.35E-07 mr1643_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 2.03E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 4.71E-07 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 9.69E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 1.44E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 7.32E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 3.23E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 8.49E-06 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 1.96E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 5.87E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 9.71E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 8.95E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 9.66E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 3.14E-06 1.79E-06 mr1956_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 5.75E-06 5.75E-06 mr1967_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710393345 NA 1.71E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251