\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710369624:

Variant ID: vg0710369624 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10369624
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATCTCTCGCCGTTTGTCATTTATTTGTAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCA[A/G]
ACCAAATCATCACCACAAGAGAGCTCGATGTACGTACAAATAAATTCAAATTTTCATTGCGTACGTATTGATTTGTTGTTTAGTTACTAATTAATTTCAT

Reverse complement sequence

ATGAAATTAATTAGTAACTAAACAACAAATCAATACGTACGCAATGAAAATTTGAATTTATTTGTACGTACATCGAGCTCTCTTGTGGTGATGATTTGGT[T/C]
TGCAAGGCAGTGGCAATACTCACACACGTAGTAGCCGCACAAGTTAGTTCCCTGCTTTTGCTTTGCGCACTACAAATAAATGACAAACGGCGAGAGATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.50% 2.70% 22.77% 38.00% NA
All Indica  2759 7.50% 4.30% 31.24% 56.98% NA
All Japonica  1512 87.00% 0.20% 7.41% 5.42% NA
Aus  269 58.70% 1.10% 27.14% 13.01% NA
Indica I  595 6.40% 2.90% 38.32% 52.44% NA
Indica II  465 6.00% 1.70% 28.17% 64.09% NA
Indica III  913 3.80% 7.00% 29.79% 59.36% NA
Indica Intermediate  786 13.50% 3.70% 29.39% 53.44% NA
Temperate Japonica  767 81.50% 0.10% 14.47% 3.91% NA
Tropical Japonica  504 90.70% 0.20% 0.20% 8.93% NA
Japonica Intermediate  241 96.70% 0.40% 0.00% 2.90% NA
VI/Aromatic  96 7.30% 3.10% 8.33% 81.25% NA
Intermediate  90 44.40% 0.00% 23.33% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710369624 A -> DEL LOC_Os07g17540.1 N frameshift_variant Average:16.0; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 N N N N
vg0710369624 A -> G LOC_Os07g17540.1 missense_variant ; p.Asn683Asp; MODERATE nonsynonymous_codon Average:16.0; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 benign 0.921 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710369624 NA 3.22E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 2.21E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 8.76E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 6.08E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 2.61E-15 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 2.82E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 1.65E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 1.39E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 2.50E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 4.38E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 3.37E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 4.84E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 2.04E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 6.37E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 5.19E-06 5.19E-06 mr1365_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 6.53E-06 4.78E-07 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 6.19E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 3.06E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 4.42E-06 8.50E-07 mr1788_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 1.31E-06 1.31E-06 mr1967_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710369624 NA 8.56E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251