\
| Variant ID: vg0710361771 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10361771 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAAGACCACTGGTCGAAGATCTTAAACTATTGTGGAAAAAGAAAGGTGTCCCCATGTGGGACGAGGACAAACAAGAGGAGTTTAACCTACTAGCGCTGTT[G/A]
TTCGTAACCATCAACGATTGGCCTGCACTTAGCAACCTTTCCGGTCAGTCCAACAAGGGGTACAAGGCTTGCATTCACTGTATGGATGAAACAGAAAGTA
TACTTTCTGTTTCATCCATACAGTGAATGCAAGCCTTGTACCCCTTGTTGGACTGACCGGAAAGGTTGCTAAGTGCAGGCCAATCGTTGATGGTTACGAA[C/T]
AACAGCGCTAGTAGGTTAAACTCCTCTTGTTTGTCCTCGTCCCACATGGGGACACCTTTCTTTTTCCACAATAGTTTAAGATCTTCGACCAGTGGTCTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 3.40% | 0.55% | 0.80% | NA |
| All Indica | 2759 | 96.00% | 3.20% | 0.83% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 4.60% | 0.20% | 2.51% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 6.70% | 2.18% | 0.00% | NA |
| Indica II | 465 | 97.40% | 1.90% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 4.10% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 91.00% | 9.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.90% | 0.20% | 0.60% | 7.34% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710361771 | G -> DEL | LOC_Os07g17530.1 | N | frameshift_variant | Average:23.56; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0710361771 | G -> A | LOC_Os07g17530.1 | synonymous_variant ; p.Leu259Leu; LOW | synonymous_codon | Average:23.56; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710361771 | NA | 1.48E-08 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | 4.64E-07 | 9.93E-08 | mr1265 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | 7.27E-06 | 2.05E-06 | mr1265 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | 8.56E-06 | 2.13E-06 | mr1304 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | NA | 2.35E-06 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | 1.30E-06 | 1.30E-06 | mr1369 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | NA | 2.49E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | 2.17E-06 | 1.45E-06 | mr1528 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | 4.03E-06 | 2.15E-06 | mr1528 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | NA | 8.15E-06 | mr1616 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | NA | 1.94E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | NA | 7.38E-09 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | NA | 2.03E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | NA | 2.29E-06 | mr1701 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | NA | 8.59E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710361771 | NA | 9.91E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |