\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710360007:

Variant ID: vg0710360007 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10360007
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, T: 0.20, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTCCCACCCCTATATATATATGTCTTCTTCCTCCTCCAGCTGCCCGAGCAAGCTTCAAAATTTCTTCAAAAAAGAGGGGAGGTCATGCCAAAATTTCT[T/A]
GTGAATTTATTTTGGTGATTATATATAAATCAGAGGTGCCTAAAAGGTTAGCAACTTCATCCTCCAATGTTTTTTTTGTCATATTACATTTGGAGCTATG

Reverse complement sequence

CATAGCTCCAAATGTAATATGACAAAAAAAACATTGGAGGATGAAGTTGCTAACCTTTTAGGCACCTCTGATTTATATATAATCACCAAAATAAATTCAC[A/T]
AGAAATTTTGGCATGACCTCCCCTCTTTTTTGAAGAAATTTTGAAGCTTGCTCGGGCAGCTGGAGGAGGAAGAAGACATATATATATAGGGGTGGGACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 35.10% 3.22% 0.97% NA
All Indica  2759 92.00% 6.30% 1.63% 0.11% NA
All Japonica  1512 10.10% 86.60% 0.46% 2.84% NA
Aus  269 42.00% 49.40% 8.55% 0.00% NA
Indica I  595 89.60% 6.20% 3.87% 0.34% NA
Indica II  465 92.90% 6.00% 1.08% 0.00% NA
Indica III  913 98.40% 1.40% 0.22% 0.00% NA
Indica Intermediate  786 85.80% 12.20% 1.91% 0.13% NA
Temperate Japonica  767 18.80% 81.10% 0.13% 0.00% NA
Tropical Japonica  504 1.00% 90.30% 0.40% 8.33% NA
Japonica Intermediate  241 1.20% 96.70% 1.66% 0.41% NA
VI/Aromatic  96 17.70% 7.30% 75.00% 0.00% NA
Intermediate  90 53.30% 41.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710360007 T -> DEL N N silent_mutation Average:11.439; most accessible tissue: Callus, score: 21.168 N N N N
vg0710360007 T -> A LOC_Os07g17520.1 upstream_gene_variant ; 4709.0bp to feature; MODIFIER silent_mutation Average:11.439; most accessible tissue: Callus, score: 21.168 N N N N
vg0710360007 T -> A LOC_Os07g17530.1 upstream_gene_variant ; 745.0bp to feature; MODIFIER silent_mutation Average:11.439; most accessible tissue: Callus, score: 21.168 N N N N
vg0710360007 T -> A LOC_Os07g17520-LOC_Os07g17530 intergenic_region ; MODIFIER silent_mutation Average:11.439; most accessible tissue: Callus, score: 21.168 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710360007 NA 8.56E-07 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 5.88E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 3.83E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 9.23E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 4.30E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 4.27E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 2.87E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 8.80E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 1.70E-07 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 4.11E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 4.43E-06 5.81E-07 mr1279 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 1.41E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 6.80E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 2.18E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 2.51E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 5.91E-06 mr1590 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 1.87E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 5.73E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 5.16E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 3.76E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 4.33E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 4.91E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 1.57E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 9.86E-08 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 8.41E-06 8.41E-06 mr1811 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 2.38E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 6.48E-07 1.93E-09 mr1887 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 4.86E-06 mr1964 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 1.48E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 3.80E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710360007 NA 1.50E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251