\
| Variant ID: vg0710335701 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10335701 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTCCCTTGCGGAGGCGAAATCGAAGCCTTCACAACTTTCCATGGCACACCACAACCTTGGGTGCTCACCGGCAACGCCTAGTCGTCTAGGAGACCTTAGT[A/C]
CCCAGGAGTAACAATCACAATCGAAGCTTTGCTTGCTATGAACTCGAGTACTCAAAGTATGTAGTGAAGCTCACTAGCTCTCAACTTCTCAATCCAACTC
GAGTTGGATTGAGAAGTTGAGAGCTAGTGAGCTTCACTACATACTTTGAGTACTCGAGTTCATAGCAAGCAAAGCTTCGATTGTGATTGTTACTCCTGGG[T/G]
ACTAAGGTCTCCTAGACGACTAGGCGTTGCCGGTGAGCACCCAAGGTTGTGGTGTGCCATGGAAAGTTGTGAAGGCTTCGATTTCGCCTCCGCAAGGGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.00% | 11.50% | 0.42% | 58.13% | NA |
| All Indica | 2759 | 5.30% | 2.80% | 0.65% | 91.26% | NA |
| All Japonica | 1512 | 72.20% | 23.50% | 0.00% | 4.37% | NA |
| Aus | 269 | 50.90% | 9.30% | 0.00% | 39.78% | NA |
| Indica I | 595 | 9.10% | 0.30% | 0.34% | 90.25% | NA |
| Indica II | 465 | 6.70% | 0.00% | 1.08% | 92.26% | NA |
| Indica III | 913 | 1.40% | 1.60% | 0.66% | 96.28% | NA |
| Indica Intermediate | 786 | 6.00% | 7.80% | 0.64% | 85.62% | NA |
| Temperate Japonica | 767 | 57.50% | 40.80% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 89.70% | 0.60% | 0.00% | 9.72% | NA |
| Japonica Intermediate | 241 | 82.20% | 16.20% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 4.20% | 81.20% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 43.30% | 7.80% | 2.22% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710335701 | A -> DEL | N | N | silent_mutation | Average:11.58; most accessible tissue: Callus, score: 55.093 | N | N | N | N |
| vg0710335701 | A -> C | LOC_Os07g17490-LOC_Os07g17500 | intergenic_region ; MODIFIER | silent_mutation | Average:11.58; most accessible tissue: Callus, score: 55.093 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710335701 | NA | 1.12E-14 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710335701 | NA | 6.92E-06 | mr1387 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710335701 | NA | 2.41E-18 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710335701 | NA | 3.08E-13 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710335701 | NA | 7.60E-12 | mr1666 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710335701 | NA | 9.48E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710335701 | NA | 2.15E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710335701 | NA | 4.40E-11 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |