\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710331865:

Variant ID: vg0710331865 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10331865
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCACTTCCGTCAATTTTTCCGACCGTCTTGATCGTTATTGACCCAGTTACGCACACGATATGACGTTTCTACCTCTCATTGACATGCATTCTACTTGTA[T/C]
TTGTGAGGGGTAGAAACGTCATATCGTGTGTGTGGCTGGAGACGGACGAAAAACGATCGAGAATTGACGGAAGTGCTAAAAATAGGAACAGGGTGAACTT

Reverse complement sequence

AAGTTCACCCTGTTCCTATTTTTAGCACTTCCGTCAATTCTCGATCGTTTTTCGTCCGTCTCCAGCCACACACACGATATGACGTTTCTACCCCTCACAA[A/G]
TACAAGTAGAATGCATGTCAATGAGAGGTAGAAACGTCATATCGTGTGCGTAACTGGGTCAATAACGATCAAGACGGTCGGAAAAATTGACGGAAGTGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.10% 7.40% 0.34% 58.19% NA
All Indica  2759 5.80% 2.90% 0.51% 90.79% NA
All Japonica  1512 84.10% 11.60% 0.00% 4.37% NA
Aus  269 50.90% 9.30% 0.74% 39.03% NA
Indica I  595 10.10% 0.30% 0.34% 89.24% NA
Indica II  465 6.70% 0.00% 1.51% 91.83% NA
Indica III  913 1.60% 1.60% 0.22% 96.50% NA
Indica Intermediate  786 6.70% 8.10% 0.38% 84.73% NA
Temperate Japonica  767 76.40% 21.90% 0.00% 1.69% NA
Tropical Japonica  504 89.90% 0.40% 0.00% 9.72% NA
Japonica Intermediate  241 96.30% 2.10% 0.00% 1.66% NA
VI/Aromatic  96 6.20% 60.40% 0.00% 33.33% NA
Intermediate  90 43.30% 10.00% 0.00% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710331865 T -> DEL N N silent_mutation Average:7.49; most accessible tissue: Callus, score: 26.895 N N N N
vg0710331865 T -> C LOC_Os07g17490.1 upstream_gene_variant ; 2691.0bp to feature; MODIFIER silent_mutation Average:7.49; most accessible tissue: Callus, score: 26.895 N N N N
vg0710331865 T -> C LOC_Os07g17490-LOC_Os07g17500 intergenic_region ; MODIFIER silent_mutation Average:7.49; most accessible tissue: Callus, score: 26.895 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710331865 NA 3.66E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 NA 5.70E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 NA 7.59E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 4.27E-06 NA mr1074_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 2.39E-06 9.32E-06 mr1148_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 6.21E-06 6.21E-06 mr1262_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 6.68E-06 3.62E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 2.20E-06 6.57E-07 mr1381_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 NA 9.40E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 1.26E-07 1.26E-07 mr1569_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 NA 4.85E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 NA 3.17E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 NA 8.37E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 2.23E-07 3.92E-07 mr1788_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 NA 4.86E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 8.26E-06 4.66E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 5.61E-06 5.61E-06 mr1967_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710331865 NA 6.70E-06 mr1976_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251