\
| Variant ID: vg0710326904 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10326904 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCCAATACACCAGATCAATCCTTTTCTTCAACAACATCCAAAGGTACATATATTAAGATAAATCTTCAACATGATCAATATAGCTCTTCAGCTCAGTGA[C/T]
AACATCCATCAGTACTCTTAAATTCGAAACGAGCACCTCCACAAAGTACTCTTGCCTAGCTCGAACCTTCAAAAGGTACAATAATTCCACCCATCAGTCT
AGACTGATGGGTGGAATTATTGTACCTTTTGAAGGTTCGAGCTAGGCAAGAGTACTTTGTGGAGGTGCTCGTTTCGAATTTAAGAGTACTGATGGATGTT[G/A]
TCACTGAGCTGAAGAGCTATATTGATCATGTTGAAGATTTATCTTAATATATGTACCTTTGGATGTTGTTGAAGAAAAGGATTGATCTGGTGTATTGGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.20% | 3.90% | 0.49% | 59.37% | NA |
| All Indica | 2759 | 6.70% | 0.00% | 0.80% | 92.50% | NA |
| All Japonica | 1512 | 82.30% | 12.10% | 0.00% | 5.56% | NA |
| Aus | 269 | 60.20% | 0.00% | 0.37% | 39.41% | NA |
| Indica I | 595 | 4.00% | 0.00% | 0.67% | 95.29% | NA |
| Indica II | 465 | 5.20% | 0.00% | 1.08% | 93.76% | NA |
| Indica III | 913 | 3.30% | 0.10% | 0.77% | 95.84% | NA |
| Indica Intermediate | 786 | 13.50% | 0.00% | 0.76% | 85.75% | NA |
| Temperate Japonica | 767 | 79.00% | 19.30% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 86.70% | 0.20% | 0.00% | 13.10% | NA |
| Japonica Intermediate | 241 | 83.80% | 14.10% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 79.20% | 1.00% | 0.00% | 19.79% | NA |
| Intermediate | 90 | 50.00% | 0.00% | 0.00% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710326904 | C -> DEL | LOC_Os07g17490.1 | N | frameshift_variant | Average:8.961; most accessible tissue: Callus, score: 43.869 | N | N | N | N |
| vg0710326904 | C -> T | LOC_Os07g17490.1 | missense_variant ; p.Val370Ile; MODERATE | nonsynonymous_codon ; V370I | Average:8.961; most accessible tissue: Callus, score: 43.869 | unknown | unknown | TOLERATED | 0.39 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710326904 | NA | 5.02E-18 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0710326904 | NA | 1.54E-09 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0710326904 | NA | 6.37E-06 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | NA | 5.64E-06 | mr1052 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | 8.28E-06 | NA | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | NA | 1.09E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | NA | 9.75E-14 | mr1624 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | NA | 8.28E-10 | mr1624 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | NA | 1.11E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | NA | 3.69E-11 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | NA | 2.43E-07 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | NA | 8.03E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710326904 | NA | 1.13E-08 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |