| Variant ID: vg0710325080 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10325080 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCTTTGCAATTTTGTTCAAAAGCAGTTTTTCAGCAGCAGTATTAATAGCTTCAGGAATCACATAAGGATGAGAAACTTTTCTCCAAATATCATAATCTT[C/T]
AGCCATAATATAAGATTGCATCCTACTACACCAAATAAGAAAAATCCGTTCCATCGAAAACATGAGCCTTAGTTGAAAACCTAGCGGGAGTAGCCATGGC
GCCATGGCTACTCCCGCTAGGTTTTCAACTAAGGCTCATGTTTTCGATGGAACGGATTTTTCTTATTTGGTGTAGTAGGATGCAATCTTATATTATGGCT[G/A]
AAGATTATGATATTTGGAGAAAAGTTTCTCATCCTTATGTGATTCCTGAAGCTATTAATACTGCTGCTGAAAAACTGCTTTTGAACAAAATTGCAAAGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 2.50% | 0.59% | 1.31% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.90% | 7.80% | 0.93% | 3.37% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 83.30% | 15.40% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 0.00% | 0.79% | 9.72% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 79.20% | 0.00% | 14.58% | 6.25% | NA |
| Intermediate | 90 | 93.30% | 1.10% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710325080 | C -> DEL | N | N | silent_mutation | Average:18.533; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0710325080 | C -> T | LOC_Os07g17480.1 | upstream_gene_variant ; 989.0bp to feature; MODIFIER | silent_mutation | Average:18.533; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0710325080 | C -> T | LOC_Os07g17490.1 | downstream_gene_variant ; 1777.0bp to feature; MODIFIER | silent_mutation | Average:18.533; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0710325080 | C -> T | LOC_Os07g17480-LOC_Os07g17490 | intergenic_region ; MODIFIER | silent_mutation | Average:18.533; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710325080 | NA | 1.73E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710325080 | NA | 1.58E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710325080 | 8.76E-07 | NA | mr1035_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710325080 | NA | 8.83E-06 | mr1266_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710325080 | 3.50E-06 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710325080 | NA | 3.21E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |