\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710325080:

Variant ID: vg0710325080 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10325080
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTTTGCAATTTTGTTCAAAAGCAGTTTTTCAGCAGCAGTATTAATAGCTTCAGGAATCACATAAGGATGAGAAACTTTTCTCCAAATATCATAATCTT[C/T]
AGCCATAATATAAGATTGCATCCTACTACACCAAATAAGAAAAATCCGTTCCATCGAAAACATGAGCCTTAGTTGAAAACCTAGCGGGAGTAGCCATGGC

Reverse complement sequence

GCCATGGCTACTCCCGCTAGGTTTTCAACTAAGGCTCATGTTTTCGATGGAACGGATTTTTCTTATTTGGTGTAGTAGGATGCAATCTTATATTATGGCT[G/A]
AAGATTATGATATTTGGAGAAAAGTTTCTCATCCTTATGTGATTCCTGAAGCTATTAATACTGCTGCTGAAAAACTGCTTTTGAACAAAATTGCAAAGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 2.50% 0.59% 1.31% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 87.90% 7.80% 0.93% 3.37% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 83.30% 15.40% 1.30% 0.00% NA
Tropical Japonica  504 89.50% 0.00% 0.79% 9.72% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 79.20% 0.00% 14.58% 6.25% NA
Intermediate  90 93.30% 1.10% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710325080 C -> DEL N N silent_mutation Average:18.533; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0710325080 C -> T LOC_Os07g17480.1 upstream_gene_variant ; 989.0bp to feature; MODIFIER silent_mutation Average:18.533; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0710325080 C -> T LOC_Os07g17490.1 downstream_gene_variant ; 1777.0bp to feature; MODIFIER silent_mutation Average:18.533; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0710325080 C -> T LOC_Os07g17480-LOC_Os07g17490 intergenic_region ; MODIFIER silent_mutation Average:18.533; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710325080 NA 1.73E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710325080 NA 1.58E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710325080 8.76E-07 NA mr1035_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710325080 NA 8.83E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710325080 3.50E-06 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710325080 NA 3.21E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251