\
| Variant ID: vg0710292737 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10292737 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACACAGCGGGACCGCCGTGTGCGTTGCCCCTTAGATTTCGCTTAGGGTTTTATATCTATCTTACTTTTTATTACTATTGTATATTTGATATGACATGGTA[G/A]
GATAGATCCCCTCAGAAAAATTAAGTGTAATTTATGCTCTTCCAATAATTGCACCTATTACGGTTGTGATCATAAGTGATGGGTTTGCCATAGCAAAGTG
CACTTTGCTATGGCAAACCCATCACTTATGATCACAACCGTAATAGGTGCAATTATTGGAAGAGCATAAATTACACTTAATTTTTCTGAGGGGATCTATC[C/T]
TACCATGTCATATCAAATATACAATAGTAATAAAAAGTAAGATAGATATAAAACCCTAAGCGAAATCTAAGGGGCAACGCACACGGCGGTCCCGCTGTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 36.30% | 0.38% | 7.15% | NA |
| All Indica | 2759 | 90.70% | 4.00% | 0.29% | 5.04% | NA |
| All Japonica | 1512 | 1.30% | 94.10% | 0.00% | 4.56% | NA |
| Aus | 269 | 26.00% | 54.60% | 2.60% | 16.73% | NA |
| Indica I | 595 | 96.50% | 0.80% | 0.34% | 2.35% | NA |
| Indica II | 465 | 91.80% | 3.70% | 0.22% | 4.30% | NA |
| Indica III | 913 | 93.40% | 0.30% | 0.11% | 6.13% | NA |
| Indica Intermediate | 786 | 82.60% | 10.70% | 0.51% | 6.23% | NA |
| Temperate Japonica | 767 | 1.80% | 98.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 0.60% | 87.10% | 0.00% | 12.30% | NA |
| Japonica Intermediate | 241 | 1.20% | 96.30% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 17.70% | 4.20% | 2.08% | 76.04% | NA |
| Intermediate | 90 | 47.80% | 37.80% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710292737 | G -> DEL | N | N | silent_mutation | Average:35.038; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0710292737 | G -> A | LOC_Os07g17440.1 | upstream_gene_variant ; 720.0bp to feature; MODIFIER | silent_mutation | Average:35.038; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0710292737 | G -> A | LOC_Os07g17430.1 | downstream_gene_variant ; 1587.0bp to feature; MODIFIER | silent_mutation | Average:35.038; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0710292737 | G -> A | LOC_Os07g17430-LOC_Os07g17440 | intergenic_region ; MODIFIER | silent_mutation | Average:35.038; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710292737 | NA | 2.49E-15 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710292737 | NA | 4.43E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710292737 | NA | 5.23E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710292737 | 7.14E-06 | 1.80E-10 | mr1716 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710292737 | NA | 8.49E-06 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710292737 | NA | 4.97E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |