\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710286016:

Variant ID: vg0710286016 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10286016
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TGATATATCATGGCATGTACAATTAGCTACATAAATTACAAATATGGCTGTGGATTGTATAAGTACTAGTGATAGTTTATTTTGTTATTTGGATGATTGA[C/A]
AAATAATAAACTAGTTGACTAATAAATAGAAAAAGGACGCCACTACACAGCATGTGGTCTCATGATAGTCTAAACTACTGTCCCAATTATTTTCATAACT

Reverse complement sequence

AGTTATGAAAATAATTGGGACAGTAGTTTAGACTATCATGAGACCACATGCTGTGTAGTGGCGTCCTTTTTCTATTTATTAGTCAACTAGTTTATTATTT[G/T]
TCAATCATCCAAATAACAAAATAAACTATCACTAGTACTTATACAATCCACAGCCATATTTGTAATTTATGTAGCTAATTGTACATGCCATGATATATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 1.20% 0.53% 0.99% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 92.00% 3.80% 1.26% 2.91% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 91.40% 7.60% 1.04% 0.00% NA
Tropical Japonica  504 89.50% 0.00% 2.18% 8.33% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 93.80% 0.00% 5.21% 1.04% NA
Intermediate  90 95.60% 1.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710286016 C -> DEL N N silent_mutation Average:66.543; most accessible tissue: Callus, score: 87.329 N N N N
vg0710286016 C -> A LOC_Os07g17430.1 upstream_gene_variant ; 4252.0bp to feature; MODIFIER silent_mutation Average:66.543; most accessible tissue: Callus, score: 87.329 N N N N
vg0710286016 C -> A LOC_Os07g17410.1 downstream_gene_variant ; 2815.0bp to feature; MODIFIER silent_mutation Average:66.543; most accessible tissue: Callus, score: 87.329 N N N N
vg0710286016 C -> A LOC_Os07g17420.1 intron_variant ; MODIFIER silent_mutation Average:66.543; most accessible tissue: Callus, score: 87.329 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710286016 NA 8.57E-08 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 2.52E-06 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 1.27E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 1.04E-07 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 6.36E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 8.59E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 9.18E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 5.90E-06 5.90E-06 mr1342_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 2.13E-06 mr1381_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 8.72E-06 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 8.60E-06 8.60E-06 mr1432_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 2.43E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 3.93E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 8.19E-06 mr1713_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710286016 NA 3.36E-06 mr1735_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251