Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710257925:

Variant ID: vg0710257925 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10257925
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTGAACTCGTCACTTTCGGTCTTTCTTGAACAACATCGTCTTCAACTTGATCGTGCTCTACAAACCCATGTAAGTTTTGTTTGTTCACTGCTCTAGAT[C/T]
TAATTTTATAATGAAGTTTCCTAACTTATGTGCCTTTTTCATTTCTCGCTGAAAAAAAAGATCCAACACAAACAATTTTGATTATCTTTACATCATCAGA

Reverse complement sequence

TCTGATGATGTAAAGATAATCAAAATTGTTTGTGTTGGATCTTTTTTTTCAGCGAGAAATGAAAAAGGCACATAAGTTAGGAAACTTCATTATAAAATTA[G/A]
ATCTAGAGCAGTGAACAAACAAAACTTACATGGGTTTGTAGAGCACGATCAAGTTGAAGACGATGTTGTTCAAGAAAGACCGAAAGTGACGAGTTCACCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.70%	14.70%	0.57%	0.00%	NA
All Indica	2759	99.30%	0.60%	0.07%	0.00%	NA
All Japonica	1512	63.60%	35.10%	1.26%	0.00%	NA
Aus	269	47.60%	50.90%	1.49%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.50%	0.13%	0.00%	NA
Temperate Japonica	767	96.30%	2.50%	1.17%	0.00%	NA
Tropical Japonica	504	23.40%	75.20%	1.39%	0.00%	NA
Japonica Intermediate	241	43.60%	55.20%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	13.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710257925	C -> T	LOC_Os07g17390.1	upstream_gene_variant ; 4123.0bp to feature; MODIFIER	silent_mutation	Average:43.027; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0710257925	C -> T	LOC_Os07g17380.1	downstream_gene_variant ; 2699.0bp to feature; MODIFIER	silent_mutation	Average:43.027; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0710257925	C -> T	LOC_Os07g17370.1	intron_variant ; MODIFIER	silent_mutation	Average:43.027; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710257925	NA	2.03E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	7.28E-18	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	9.16E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	2.60E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	5.52E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	5.51E-16	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	6.93E-13	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	3.52E-07	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	2.25E-13	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	2.46E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	1.11E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	7.77E-12	mr1363_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	4.90E-07	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	3.52E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	1.04E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	2.15E-16	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	6.87E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	6.18E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	1.59E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	1.16E-07	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	3.18E-12	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	3.10E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	1.13E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	9.05E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710257925	NA	7.42E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251