\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710253991:

Variant ID: vg0710253991 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10253991
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCTACAGGTGCCACGTATTAGATGGTGCCTGACACAATCAACCCCCTGCCCCACCCCCACGCACATTCAATTTAAACAGACCACGTAGTTAAATTTTAA[A/C]
TCAGCGACCTACCACCCCGCACCCCCACATGAACTCGATCTGGTGCAAGCTACACACTTAACTGTTAACTCAACCACCCACCCCCACACGCAAGTTAAAT

Reverse complement sequence

ATTTAACTTGCGTGTGGGGGTGGGTGGTTGAGTTAACAGTTAAGTGTGTAGCTTGCACCAGATCGAGTTCATGTGGGGGTGCGGGGTGGTAGGTCGCTGA[T/G]
TTAAAATTTAACTACGTGGTCTGTTTAAATTGAATGTGCGTGGGGGTGGGGCAGGGGGTTGATTGTGTCAGGCACCATCTAATACGTGGCACCTGTAGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 26.70% 9.04% 27.85% NA
All Indica  2759 3.70% 37.70% 13.99% 44.62% NA
All Japonica  1512 94.10% 4.70% 0.33% 0.86% NA
Aus  269 53.90% 27.90% 3.35% 14.87% NA
Indica I  595 0.70% 42.90% 9.92% 46.55% NA
Indica II  465 3.40% 41.30% 16.56% 38.71% NA
Indica III  913 0.20% 32.00% 15.88% 51.92% NA
Indica Intermediate  786 10.10% 38.40% 13.36% 38.17% NA
Temperate Japonica  767 98.00% 0.30% 0.26% 1.43% NA
Tropical Japonica  504 87.30% 12.30% 0.20% 0.20% NA
Japonica Intermediate  241 95.90% 2.90% 0.83% 0.41% NA
VI/Aromatic  96 19.80% 52.10% 18.75% 9.38% NA
Intermediate  90 36.70% 27.80% 10.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710253991 A -> DEL N N silent_mutation Average:56.232; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0710253991 A -> C LOC_Os07g17370.1 upstream_gene_variant ; 3713.0bp to feature; MODIFIER silent_mutation Average:56.232; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0710253991 A -> C LOC_Os07g17360.1 downstream_gene_variant ; 1300.0bp to feature; MODIFIER silent_mutation Average:56.232; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0710253991 A -> C LOC_Os07g17360.2 downstream_gene_variant ; 1300.0bp to feature; MODIFIER silent_mutation Average:56.232; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0710253991 A -> C LOC_Os07g17360-LOC_Os07g17370 intergenic_region ; MODIFIER silent_mutation Average:56.232; most accessible tissue: Minghui63 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710253991 NA 3.98E-14 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 1.56E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 1.68E-55 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 7.68E-27 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 2.13E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 1.07E-14 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 4.80E-35 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 3.12E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 3.29E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 6.36E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 4.74E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 2.48E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 3.21E-06 3.21E-06 mr1877 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 1.18E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 1.41E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991 NA 1.33E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251