Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710253991:

Variant ID: vg0710253991 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10253991
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCTACAGGTGCCACGTATTAGATGGTGCCTGACACAATCAACCCCCTGCCCCACCCCCACGCACATTCAATTTAAACAGACCACGTAGTTAAATTTTAA[A/C]
TCAGCGACCTACCACCCCGCACCCCCACATGAACTCGATCTGGTGCAAGCTACACACTTAACTGTTAACTCAACCACCCACCCCCACACGCAAGTTAAAT

Reverse complement sequence

ATTTAACTTGCGTGTGGGGGTGGGTGGTTGAGTTAACAGTTAAGTGTGTAGCTTGCACCAGATCGAGTTCATGTGGGGGTGCGGGGTGGTAGGTCGCTGA[T/G]
TTAAAATTTAACTACGTGGTCTGTTTAAATTGAATGTGCGTGGGGGTGGGGCAGGGGGTTGATTGTGTCAGGCACCATCTAATACGTGGCACCTGTAGCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	26.70%	9.04%	27.85%	NA
All Indica	2759	3.70%	37.70%	13.99%	44.62%	NA
All Japonica	1512	94.10%	4.70%	0.33%	0.86%	NA
Aus	269	53.90%	27.90%	3.35%	14.87%	NA
Indica I	595	0.70%	42.90%	9.92%	46.55%	NA
Indica II	465	3.40%	41.30%	16.56%	38.71%	NA
Indica III	913	0.20%	32.00%	15.88%	51.92%	NA
Indica Intermediate	786	10.10%	38.40%	13.36%	38.17%	NA
Temperate Japonica	767	98.00%	0.30%	0.26%	1.43%	NA
Tropical Japonica	504	87.30%	12.30%	0.20%	0.20%	NA
Japonica Intermediate	241	95.90%	2.90%	0.83%	0.41%	NA
VI/Aromatic	96	19.80%	52.10%	18.75%	9.38%	NA
Intermediate	90	36.70%	27.80%	10.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710253991	A -> DEL	N	N	silent_mutation	Average:56.232; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0710253991	A -> C	LOC_Os07g17370.1	upstream_gene_variant ; 3713.0bp to feature; MODIFIER	silent_mutation	Average:56.232; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0710253991	A -> C	LOC_Os07g17360.1	downstream_gene_variant ; 1300.0bp to feature; MODIFIER	silent_mutation	Average:56.232; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0710253991	A -> C	LOC_Os07g17360.2	downstream_gene_variant ; 1300.0bp to feature; MODIFIER	silent_mutation	Average:56.232; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0710253991	A -> C	LOC_Os07g17360-LOC_Os07g17370	intergenic_region ; MODIFIER	silent_mutation	Average:56.232; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710253991	NA	3.98E-14	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	1.56E-21	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	1.68E-55	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	7.68E-27	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	2.13E-11	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	1.07E-14	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	4.80E-35	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	3.12E-10	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	3.29E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	6.36E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	4.74E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	2.48E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	3.21E-06	3.21E-06	mr1877	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	1.18E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	1.41E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710253991	NA	1.33E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251