Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710222643:

Variant ID: vg0710222643 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10222643
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTATATAATGCGGGAAATTCAAAGGAGTCTTGCACTGGTGTCGTTATTTGAAGTAGAATCAGCTCATATCTCCTTATTTTTAGATAATGGAATAGATAA[T/C]
ATCATGGCCTTTGCTCAATATAGCTACAGCCAATTATTACAAAGAATCACTCAAACAAAGAGTGTAGTTCAAACCAAATTAAACACACTCAGGTAAAAAT

Reverse complement sequence

ATTTTTACCTGAGTGTGTTTAATTTGGTTTGAACTACACTCTTTGTTTGAGTGATTCTTTGTAATAATTGGCTGTAGCTATATTGAGCAAAGGCCATGAT[A/G]
TTATCTATTCCATTATCTAAAAATAAGGAGATATGAGCTGATTCTACTTCAAATAACGACACCAGTGCAAGACTCCTTTGAATTTCCCGCATTATATACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	35.20%	0.00%	0.00%	NA
All Indica	2759	96.40%	3.60%	0.00%	0.00%	NA
All Japonica	1512	8.30%	91.70%	0.00%	0.00%	NA
Aus	269	46.10%	53.90%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	89.90%	10.10%	0.00%	0.00%	NA
Temperate Japonica	767	6.90%	93.10%	0.00%	0.00%	NA
Tropical Japonica	504	12.70%	87.30%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710222643	T -> C	LOC_Os07g17300.1	upstream_gene_variant ; 1910.0bp to feature; MODIFIER	silent_mutation	Average:28.83; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0710222643	T -> C	LOC_Os07g17310.1	upstream_gene_variant ; 879.0bp to feature; MODIFIER	silent_mutation	Average:28.83; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0710222643	T -> C	LOC_Os07g17300-LOC_Os07g17310	intergenic_region ; MODIFIER	silent_mutation	Average:28.83; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710222643	NA	1.12E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	2.90E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	8.03E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	1.29E-21	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	3.94E-06	1.68E-23	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	4.23E-32	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	1.24E-33	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	1.36E-29	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	1.58E-39	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	7.28E-27	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	8.40E-35	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	5.58E-13	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	3.84E-24	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	1.26E-14	mr1329	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	2.02E-34	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	2.19E-39	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	1.51E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	2.96E-36	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	2.05E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	3.35E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	8.64E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	8.93E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	1.38E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710222643	NA	3.59E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251