\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710180880:

Variant ID: vg0710180880 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 10180880
Reference Allele: AAlternative Allele: G,AG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATAAGGCCAAACTTAACAAAAATTTAAGGAGATGGATTTAGGTCACAATCTATTGTTTACAAGTAGAATTTGTCTTAGCCAACTACATTGGGAAGATA[A/G,AG]
AGTCAAATAGTCACAACCAATCAACAAAATAGTTGAGATGAGGACACAGCGACGATGTCTGGATTAATGCCTTGATTTTTCACGGTACTAAACAAGAGTA

Reverse complement sequence

TACTCTTGTTTAGTACCGTGAAAAATCAAGGCATTAATCCAGACATCGTCGCTGTGTCCTCATCTCAACTATTTTGTTGATTGGTTGTGACTATTTGACT[T/C,CT]
TATCTTCCCAATGTAGTTGGCTAAGACAAATTCTACTTGTAAACAATAGATTGTGACCTAAATCCATCTCCTTAAATTTTTGTTAAGTTTGGCCTTATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 26.00% 21.96% 15.40% AG: 0.28%
All Indica  2759 4.70% 38.50% 31.24% 25.12% AG: 0.43%
All Japonica  1512 87.40% 7.20% 4.96% 0.46% NA
Aus  269 58.00% 7.80% 28.62% 5.20% AG: 0.37%
Indica I  595 1.50% 49.90% 25.38% 23.19% NA
Indica II  465 4.10% 33.50% 39.35% 21.94% AG: 1.08%
Indica III  913 1.30% 34.20% 31.65% 32.42% AG: 0.44%
Indica Intermediate  786 11.60% 37.70% 30.41% 19.97% AG: 0.38%
Temperate Japonica  767 93.40% 0.50% 5.35% 0.78% NA
Tropical Japonica  504 73.80% 20.20% 5.95% 0.00% NA
Japonica Intermediate  241 96.70% 1.20% 1.66% 0.41% NA
VI/Aromatic  96 78.10% 10.40% 6.25% 5.21% NA
Intermediate  90 40.00% 30.00% 20.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710180880 A -> AG LOC_Os07g17250.1 downstream_gene_variant ; 4054.0bp to feature; MODIFIER silent_mutation Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0710180880 A -> AG LOC_Os07g17260.1 intron_variant ; MODIFIER silent_mutation Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0710180880 A -> AG LOC_Os07g17260.2 intron_variant ; MODIFIER silent_mutation Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0710180880 A -> DEL N N silent_mutation Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0710180880 A -> G LOC_Os07g17250.1 downstream_gene_variant ; 4053.0bp to feature; MODIFIER silent_mutation Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0710180880 A -> G LOC_Os07g17260.1 intron_variant ; MODIFIER silent_mutation Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0710180880 A -> G LOC_Os07g17260.2 intron_variant ; MODIFIER silent_mutation Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710180880 NA 1.77E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 3.52E-14 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 3.56E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 5.97E-30 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 2.30E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 3.85E-33 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 9.53E-06 mr1139 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 2.34E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 5.95E-36 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 4.65E-08 mr1224 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 2.21E-31 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 8.67E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 8.79E-07 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 1.70E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 6.50E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 9.04E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 2.95E-22 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 3.21E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 1.69E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880 NA 8.45E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251