Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710180880:

Variant ID: vg0710180880 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 10180880
Reference Allele: A	Alternative Allele: G,AG
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATAAGGCCAAACTTAACAAAAATTTAAGGAGATGGATTTAGGTCACAATCTATTGTTTACAAGTAGAATTTGTCTTAGCCAACTACATTGGGAAGATA[A/G,AG]
AGTCAAATAGTCACAACCAATCAACAAAATAGTTGAGATGAGGACACAGCGACGATGTCTGGATTAATGCCTTGATTTTTCACGGTACTAAACAAGAGTA

Reverse complement sequence

TACTCTTGTTTAGTACCGTGAAAAATCAAGGCATTAATCCAGACATCGTCGCTGTGTCCTCATCTCAACTATTTTGTTGATTGGTTGTGACTATTTGACT[T/C,CT]
TATCTTCCCAATGTAGTTGGCTAAGACAAATTCTACTTGTAAACAATAGATTGTGACCTAAATCCATCTCCTTAAATTTTTGTTAAGTTTGGCCTTATGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	26.00%	21.96%	15.40%	AG: 0.28%
All Indica	2759	4.70%	38.50%	31.24%	25.12%	AG: 0.43%
All Japonica	1512	87.40%	7.20%	4.96%	0.46%	NA
Aus	269	58.00%	7.80%	28.62%	5.20%	AG: 0.37%
Indica I	595	1.50%	49.90%	25.38%	23.19%	NA
Indica II	465	4.10%	33.50%	39.35%	21.94%	AG: 1.08%
Indica III	913	1.30%	34.20%	31.65%	32.42%	AG: 0.44%
Indica Intermediate	786	11.60%	37.70%	30.41%	19.97%	AG: 0.38%
Temperate Japonica	767	93.40%	0.50%	5.35%	0.78%	NA
Tropical Japonica	504	73.80%	20.20%	5.95%	0.00%	NA
Japonica Intermediate	241	96.70%	1.20%	1.66%	0.41%	NA
VI/Aromatic	96	78.10%	10.40%	6.25%	5.21%	NA
Intermediate	90	40.00%	30.00%	20.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710180880	A -> AG	LOC_Os07g17250.1	downstream_gene_variant ; 4054.0bp to feature; MODIFIER	silent_mutation	Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0710180880	A -> AG	LOC_Os07g17260.1	intron_variant ; MODIFIER	silent_mutation	Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0710180880	A -> AG	LOC_Os07g17260.2	intron_variant ; MODIFIER	silent_mutation	Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0710180880	A -> DEL	N	N	silent_mutation	Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0710180880	A -> G	LOC_Os07g17250.1	downstream_gene_variant ; 4053.0bp to feature; MODIFIER	silent_mutation	Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0710180880	A -> G	LOC_Os07g17260.1	intron_variant ; MODIFIER	silent_mutation	Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0710180880	A -> G	LOC_Os07g17260.2	intron_variant ; MODIFIER	silent_mutation	Average:27.718; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710180880	NA	1.77E-12	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	3.52E-14	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	3.56E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	5.97E-30	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	2.30E-06	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	3.85E-33	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	9.53E-06	mr1139	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	2.34E-06	mr1170	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	5.95E-36	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	4.65E-08	mr1224	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	2.21E-31	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	8.67E-06	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	8.79E-07	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	1.70E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	6.50E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	9.04E-06	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	2.95E-22	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	3.21E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	1.69E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710180880	NA	8.45E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251