\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710123448:

Variant ID: vg0710123448 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10123448
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GAGATGTGAGACTACTCACGAAAAACATTGCTCAACCCGCCCATTACCGCGGGCACGGCTATTCGAATAGTTTTACTCTGGCCAGATGTGTACAAATTTA[C/T]
CCACAAGACACAACTCCACAATATGTCACCCTATCACCATGTGCCCATGCTGAACATGTCACCATTTGTGTAGTTGTGACAAGACCCCTCATATAGCTCA

Reverse complement sequence

TGAGCTATATGAGGGGTCTTGTCACAACTACACAAATGGTGACATGTTCAGCATGGGCACATGGTGATAGGGTGACATATTGTGGAGTTGTGTCTTGTGG[G/A]
TAAATTTGTACACATCTGGCCAGAGTAAAACTATTCGAATAGCCGTGCCCGCGGTAATGGGCGGGTTGAGCAATGTTTTTCGTGAGTAGTCTCACATCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 2.90% 1.21% 0.55% NA
All Indica  2759 98.70% 0.00% 1.23% 0.07% NA
All Japonica  1512 88.20% 8.90% 1.39% 1.59% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 0.00% 4.20% 0.25% NA
Temperate Japonica  767 82.40% 13.80% 1.69% 2.09% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 82.60% 11.20% 2.90% 3.32% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710123448 C -> DEL N N silent_mutation Average:72.562; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0710123448 C -> T LOC_Os07g17200.1 upstream_gene_variant ; 1535.0bp to feature; MODIFIER silent_mutation Average:72.562; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0710123448 C -> T LOC_Os07g17210.1 downstream_gene_variant ; 4888.0bp to feature; MODIFIER silent_mutation Average:72.562; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0710123448 C -> T LOC_Os07g17184-LOC_Os07g17200 intergenic_region ; MODIFIER silent_mutation Average:72.562; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0710123448 C T -0.01 -0.02 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710123448 NA 7.84E-19 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0710123448 NA 1.49E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0710123448 4.32E-09 NA mr1549 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 5.81E-06 1.62E-12 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 NA 9.45E-12 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 NA 2.12E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 2.43E-06 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 NA 5.35E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 6.99E-06 4.26E-09 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 NA 5.26E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 NA 3.75E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 NA 9.35E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710123448 NA 1.82E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251