Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710080818:

Variant ID: vg0710080818 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10080818
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TGACACAACAAAACAGAAAATAGCTAAGCTAGCTCGTATGCATTATATGCCAGCCCAGCCCACATAATGAGACAACGTTTGGATGTGAGCCCACAAGGCT[G/A]
GCAGCCGTCTCCACAAATTCCCCTGCGTTGATGTCATATTCCAGTATTCCTCCATTGTGATGAATTTGGAGGCGTAGACAAGATTTTGTAAGTAACCGCT

Reverse complement sequence

AGCGGTTACTTACAAAATCTTGTCTACGCCTCCAAATTCATCACAATGGAGGAATACTGGAATATGACATCAACGCAGGGGAATTTGTGGAGACGGCTGC[C/T]
AGCCTTGTGGGCTCACATCCAAACGTTGTCTCATTATGTGGGCTGGGCTGGCATATAATGCATACGAGCTAGCTTAGCTATTTTCTGTTTTGTTGTGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.90% 5.00% 1.10% 0.00% NA
All Indica  2759 97.90% 0.40% 1.70% 0.00% NA
All Japonica  1512 86.00% 13.70% 0.26% 0.00% NA
Aus  269 95.90% 3.70% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 1.10% 5.98% 0.00% NA
Temperate Japonica  767 88.80% 10.70% 0.52% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 58.50% 41.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710080818 G -> A LOC_Os07g17150.1 upstream_gene_variant ; 757.0bp to feature; MODIFIER silent_mutation Average:40.009; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0710080818 G -> A LOC_Os07g17150-LOC_Os07g17160 intergenic_region ; MODIFIER silent_mutation Average:40.009; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710080818 NA 2.81E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 NA 5.09E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 8.51E-06 1.23E-07 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 NA 1.04E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 NA 1.99E-06 mr1381_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 NA 2.71E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 NA 2.32E-08 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 NA 1.25E-07 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 6.66E-06 6.49E-08 mr1788_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 NA 1.59E-07 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710080818 NA 7.66E-06 mr1849_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251