\
| Variant ID: vg0710080818 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10080818 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )
TGACACAACAAAACAGAAAATAGCTAAGCTAGCTCGTATGCATTATATGCCAGCCCAGCCCACATAATGAGACAACGTTTGGATGTGAGCCCACAAGGCT[G/A]
GCAGCCGTCTCCACAAATTCCCCTGCGTTGATGTCATATTCCAGTATTCCTCCATTGTGATGAATTTGGAGGCGTAGACAAGATTTTGTAAGTAACCGCT
AGCGGTTACTTACAAAATCTTGTCTACGCCTCCAAATTCATCACAATGGAGGAATACTGGAATATGACATCAACGCAGGGGAATTTGTGGAGACGGCTGC[C/T]
AGCCTTGTGGGCTCACATCCAAACGTTGTCTCATTATGTGGGCTGGGCTGGCATATAATGCATACGAGCTAGCTTAGCTATTTTCTGTTTTGTTGTGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 5.00% | 1.10% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 0.40% | 1.70% | 0.00% | NA |
| All Japonica | 1512 | 86.00% | 13.70% | 0.26% | 0.00% | NA |
| Aus | 269 | 95.90% | 3.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 1.10% | 5.98% | 0.00% | NA |
| Temperate Japonica | 767 | 88.80% | 10.70% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.50% | 41.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710080818 | G -> A | LOC_Os07g17150.1 | upstream_gene_variant ; 757.0bp to feature; MODIFIER | silent_mutation | Average:40.009; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0710080818 | G -> A | LOC_Os07g17150-LOC_Os07g17160 | intergenic_region ; MODIFIER | silent_mutation | Average:40.009; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710080818 | NA | 2.81E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | NA | 5.09E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | 8.51E-06 | 1.23E-07 | mr1318_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | NA | 1.04E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | NA | 1.99E-06 | mr1381_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | NA | 2.71E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | NA | 2.32E-08 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | NA | 1.25E-07 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | 6.66E-06 | 6.49E-08 | mr1788_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | NA | 1.59E-07 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710080818 | NA | 7.66E-06 | mr1849_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |