RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0710047549:

Variant ID: vg0710047549 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10047549
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGCCTCGTTGATAATGTCAGGTCCAAATACCGCCCGTTCACCTGTCTTCGACCACATCAGCGGAGTCCGGCATCGTCGACCAAACAATGCTTCATTGG[G/C]
GGACATCTTCAGGCTTGCTTGAAAGCTGTTGTTGTGGGAGAATTCGGCGTAGGGCAAACACCTCTCCCAGTCTTTACTAAAATCCAATGCACAGGCTCTC

Reverse complement sequence

GAGAGCCTGTGCATTGGATTTTAGTAAAGACTGGGAGAGGTGTTTGCCCTACGCCGAATTCTCCCACAACAACAGCTTTCAAGCAAGCCTGAAGATGTCC[C/G]
CCAATGAAGCATTGTTTGGTCGACGATGCCGGACTCCGCTGATGTGGTCGAAGACAGGTGAACGGGCGGTATTTGGACCTGACATTATCAACGAGGCCGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	13.40%	8.89%	5.99%	NA
All Indica	2759	53.30%	22.60%	14.75%	9.39%	NA
All Japonica	1512	99.20%	0.20%	0.07%	0.53%	NA
Aus	269	92.90%	0.00%	3.35%	3.72%	NA
Indica I	595	43.70%	46.40%	4.03%	5.88%	NA
Indica II	465	51.80%	13.80%	16.99%	17.42%	NA
Indica III	913	55.80%	13.40%	22.67%	8.21%	NA
Indica Intermediate	786	58.50%	20.50%	12.34%	8.65%	NA
Temperate Japonica	767	98.80%	0.40%	0.13%	0.65%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	5.60%	3.33%	6.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710047549	G -> DEL	LOC_Os07g17080.1	N	frameshift_variant	Average:13.947; most accessible tissue: Callus, score: 38.045	N	N	N	N
vg0710047549	G -> C	LOC_Os07g17080.1	missense_variant ; p.Pro156Ala; MODERATE	nonsynonymous_codon ; P156A	Average:13.947; most accessible tissue: Callus, score: 38.045	possibly damaging	1.698	DELETERIOUS	0.00

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710047549	NA	9.97E-10	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710047549	NA	8.60E-12	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710047549	NA	1.05E-14	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710047549	7.24E-09	NA	mr1161_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710047549	2.31E-06	4.12E-14	mr1161_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710047549	NA	6.26E-16	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710047549	NA	7.99E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 7 of 7 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0710047549:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact