Search for Variation information by Variation ID:
Detailed information for vg0710047549:
| Variant ID: vg0710047549 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10047549 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 309. )
Flanking Sequence (100 bp) in Reference Genome:
TCGGCCTCGTTGATAATGTCAGGTCCAAATACCGCCCGTTCACCTGTCTTCGACCACATCAGCGGAGTCCGGCATCGTCGACCAAACAATGCTTCATTGG[G/C]
GGACATCTTCAGGCTTGCTTGAAAGCTGTTGTTGTGGGAGAATTCGGCGTAGGGCAAACACCTCTCCCAGTCTTTACTAAAATCCAATGCACAGGCTCTC
Reverse complement sequence
GAGAGCCTGTGCATTGGATTTTAGTAAAGACTGGGAGAGGTGTTTGCCCTACGCCGAATTCTCCCACAACAACAGCTTTCAAGCAAGCCTGAAGATGTCC[C/G]
CCAATGAAGCATTGTTTGGTCGACGATGCCGGACTCCGCTGATGTGGTCGAAGACAGGTGAACGGGCGGTATTTGGACCTGACATTATCAACGAGGCCGA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.80% | 13.40% | 8.89% | 5.99% | NA |
| All Indica | 2759 | 53.30% | 22.60% | 14.75% | 9.39% | NA |
| All Japonica | 1512 | 99.20% | 0.20% | 0.07% | 0.53% | NA |
| Aus | 269 | 92.90% | 0.00% | 3.35% | 3.72% | NA |
| Indica I | 595 | 43.70% | 46.40% | 4.03% | 5.88% | NA |
| Indica II | 465 | 51.80% | 13.80% | 16.99% | 17.42% | NA |
| Indica III | 913 | 55.80% | 13.40% | 22.67% | 8.21% | NA |
| Indica Intermediate | 786 | 58.50% | 20.50% | 12.34% | 8.65% | NA |
| Temperate Japonica | 767 | 98.80% | 0.40% | 0.13% | 0.65% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 5.60% | 3.33% | 6.67% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710047549 | G -> DEL | LOC_Os07g17080.1 | N | frameshift_variant | Average:13.947; most accessible tissue: Callus, score: 38.045 | N | N | N | N |
| vg0710047549 | G -> C | LOC_Os07g17080.1 | missense_variant ; p.Pro156Ala; MODERATE | nonsynonymous_codon ; P156A | Average:13.947; most accessible tissue: Callus, score: 38.045 | possibly damaging  |
1.698 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710047549 | NA | 9.97E-10 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710047549 | NA | 8.60E-12 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710047549 | NA | 1.05E-14 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710047549 | 7.24E-09 | NA | mr1161_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710047549 | 2.31E-06 | 4.12E-14 | mr1161_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710047549 | NA | 6.26E-16 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710047549 | NA | 7.99E-07 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |