\
| Variant ID: vg0710020952 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10020952 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGAATCAGCCTCGCAACCTATTGATTGCAGTCTCGCTCGTGGCGCTAGCCAACTATGTCGTGCACATTTTTTTGAATAGTTATATATGAGTACAAGTTA[A/T]
ATATACATTTTTTTTATAGCTGCCCCCAGCTCTTCTCTCGCTCTCTCCTCGTTTTCAGTTTTTCTGCACCGATATTATAGCACATAAATCTACCTTAGAA
TTCTAAGGTAGATTTATGTGCTATAATATCGGTGCAGAAAAACTGAAAACGAGGAGAGAGCGAGAGAAGAGCTGGGGGCAGCTATAAAAAAAATGTATAT[T/A]
TAACTTGTACTCATATATAACTATTCAAAAAAATGTGCACGACATAGTTGGCTAGCGCCACGAGCGAGACTGCAATCAATAGGTTGCGAGGCTGATTCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 37.30% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.00% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 35.70% | 64.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 2.70% | 1.01% | 0.00% | NA |
| Indica II | 465 | 94.00% | 5.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 6.60% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.30% | 87.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 37.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710020952 | A -> T | LOC_Os07g17030.1 | upstream_gene_variant ; 3464.0bp to feature; MODIFIER | silent_mutation | Average:46.3; most accessible tissue: Callus, score: 78.847 | N | N | N | N |
| vg0710020952 | A -> T | LOC_Os07g17010.1 | downstream_gene_variant ; 216.0bp to feature; MODIFIER | silent_mutation | Average:46.3; most accessible tissue: Callus, score: 78.847 | N | N | N | N |
| vg0710020952 | A -> T | LOC_Os07g17020.1 | downstream_gene_variant ; 1494.0bp to feature; MODIFIER | silent_mutation | Average:46.3; most accessible tissue: Callus, score: 78.847 | N | N | N | N |
| vg0710020952 | A -> T | LOC_Os07g17010-LOC_Os07g17020 | intergenic_region ; MODIFIER | silent_mutation | Average:46.3; most accessible tissue: Callus, score: 78.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710020952 | NA | 5.10E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 2.58E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 9.42E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 6.34E-23 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 6.11E-50 | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 4.83E-22 | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 1.60E-57 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 9.45E-56 | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 5.32E-35 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 6.62E-50 | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 2.65E-33 | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 2.60E-47 | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 8.76E-21 | mr1131 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 1.67E-39 | mr1139 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 2.63E-17 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 3.17E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 6.61E-27 | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 8.12E-16 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 1.31E-51 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 1.29E-31 | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 1.16E-23 | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 1.96E-13 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 6.97E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 1.13E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 2.08E-13 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 5.18E-13 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 4.39E-34 | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 9.88E-23 | mr1416 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 1.04E-09 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 2.18E-42 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 2.75E-24 | mr1689 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 5.73E-18 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 6.25E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 1.64E-40 | mr1721 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 7.59E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 4.02E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 3.55E-32 | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 6.78E-15 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 6.61E-64 | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 2.07E-61 | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 4.02E-18 | mr1131_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 4.23E-55 | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 6.88E-37 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 7.42E-58 | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710020952 | NA | 2.45E-31 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |