\
| Variant ID: vg0709987989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9987989 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACCTGGTGACAAAACAGAAATGGGACACGTTTTTCATCATTTTCTGATGAGAATTTTTTTTTTCGCTGACAAAATAATGACAAATTCAAGATCACTCGCA[A/G]
AAAACATAAAAAAAATTGCTGGTTTGTTTCACATCATTATTTGTGAATTTGTGATTGTTAATCAGATCACAAAGCGATTCACGATCAGATCTGTCGTTTC
GAAACGACAGATCTGATCGTGAATCGCTTTGTGATCTGATTAACAATCACAAATTCACAAATAATGATGTGAAACAAACCAGCAATTTTTTTTATGTTTT[T/C]
TGCGAGTGATCTTGAATTTGTCATTATTTTGTCAGCGAAAAAAAAAATTCTCATCAGAAAATGATGAAAAACGTGTCCCATTTCTGTTTTGTCACCAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 1.00% | 1.38% | 11.68% | NA |
| All Indica | 2759 | 88.90% | 0.00% | 0.07% | 11.05% | NA |
| All Japonica | 1512 | 77.20% | 3.20% | 3.44% | 16.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.10% | 0.00% | 0.00% | 30.92% | NA |
| Indica II | 465 | 94.40% | 0.00% | 0.22% | 5.38% | NA |
| Indica III | 913 | 99.70% | 0.00% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 88.00% | 0.00% | 0.13% | 11.83% | NA |
| Temperate Japonica | 767 | 65.80% | 5.10% | 6.26% | 22.82% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 68.00% | 3.70% | 1.66% | 26.56% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 9.38% | 1.04% | NA |
| Intermediate | 90 | 94.40% | 0.00% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709987989 | A -> DEL | N | N | silent_mutation | Average:56.654; most accessible tissue: Callus, score: 79.611 | N | N | N | N |
| vg0709987989 | A -> G | LOC_Os07g16980.1 | upstream_gene_variant ; 2084.0bp to feature; MODIFIER | silent_mutation | Average:56.654; most accessible tissue: Callus, score: 79.611 | N | N | N | N |
| vg0709987989 | A -> G | LOC_Os07g16970.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.654; most accessible tissue: Callus, score: 79.611 | N | N | N | N |
| vg0709987989 | A -> G | LOC_Os07g16970.2 | intron_variant ; MODIFIER | silent_mutation | Average:56.654; most accessible tissue: Callus, score: 79.611 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709987989 | NA | 3.01E-08 | mr1624 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709987989 | NA | 5.81E-09 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709987989 | NA | 3.41E-10 | mr1733_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709987989 | NA | 4.55E-07 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709987989 | NA | 4.69E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709987989 | NA | 9.47E-06 | mr1739_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709987989 | NA | 3.85E-08 | mr1741_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709987989 | NA | 4.00E-06 | mr1751_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709987989 | NA | 1.28E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709987989 | NA | 1.20E-06 | mr1887_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |