\
| Variant ID: vg0709984421 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9984421 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACGCAAAACGAGAAACATCATCCACACATGATTTATTAAGTATTAATTATTATAAATTTTAAAAATAGATTTATTTGTTTTTTTAAATAACTTATATGTA[A/G]
AAACTTTTTGTCAAAAACACACCATTTAACAGTTTGAAAAGCGTGCTAACGGAAAACGAGGAAATTGAAGTTTGGAGTTGAAAAACAGAACTGGGACTTA
TAAGTCCCAGTTCTGTTTTTCAACTCCAAACTTCAATTTCCTCGTTTTCCGTTAGCACGCTTTTCAAACTGTTAAATGGTGTGTTTTTGACAAAAAGTTT[T/C]
TACATATAAGTTATTTAAAAAAACAAATAAATCTATTTTTAAAATTTATAATAATTAATACTTAATAAATCATGTGTGGATGATGTTTCTCGTTTTGCGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 7.60% | 0.04% | 13.80% | NA |
| All Indica | 2759 | 81.40% | 7.40% | 0.07% | 11.13% | NA |
| All Japonica | 1512 | 73.90% | 4.20% | 0.00% | 21.96% | NA |
| Aus | 269 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.20% | 0.70% | 0.00% | 31.09% | NA |
| Indica II | 465 | 94.20% | 0.20% | 0.22% | 5.38% | NA |
| Indica III | 913 | 89.50% | 10.20% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 74.30% | 13.60% | 0.13% | 11.96% | NA |
| Temperate Japonica | 767 | 66.40% | 0.50% | 0.00% | 33.12% | NA |
| Tropical Japonica | 504 | 88.30% | 10.90% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 67.60% | 1.70% | 0.00% | 30.71% | NA |
| VI/Aromatic | 96 | 64.60% | 27.10% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 85.60% | 8.90% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709984421 | A -> DEL | N | N | silent_mutation | Average:31.515; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0709984421 | A -> G | LOC_Os07g16960.1 | upstream_gene_variant ; 4077.0bp to feature; MODIFIER | silent_mutation | Average:31.515; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0709984421 | A -> G | LOC_Os07g16970.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.515; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0709984421 | A -> G | LOC_Os07g16970.2 | intron_variant ; MODIFIER | silent_mutation | Average:31.515; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709984421 | NA | 1.49E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 1.83E-06 | 9.43E-08 | mr1046_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 8.01E-07 | 8.01E-07 | mr1048_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 5.10E-06 | 7.42E-07 | mr1182_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 6.21E-08 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 1.92E-06 | 1.92E-06 | mr1282_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 4.72E-06 | mr1283_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 2.50E-06 | mr1288_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 6.25E-06 | mr1345_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 6.86E-06 | 6.86E-06 | mr1357_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 2.11E-06 | 2.11E-06 | mr1365_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 2.05E-06 | mr1366_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 5.06E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 6.59E-07 | 4.09E-08 | mr1381_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 1.06E-06 | mr1388_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 6.96E-06 | 6.96E-06 | mr1391_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 7.26E-06 | 2.84E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 4.40E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 2.25E-06 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 3.81E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 3.89E-06 | mr1442_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 6.80E-06 | 6.80E-06 | mr1475_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 5.14E-06 | 5.14E-06 | mr1512_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 5.28E-08 | mr1533_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 6.42E-07 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 3.56E-06 | 3.56E-06 | mr1573_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 2.01E-07 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 3.80E-06 | 4.57E-06 | mr1594_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 7.19E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 5.00E-07 | 5.00E-07 | mr1643_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 2.55E-06 | mr1646_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 4.55E-06 | mr1661_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 1.49E-08 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 7.52E-06 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 1.53E-06 | 1.53E-06 | mr1783_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 5.15E-06 | mr1784_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 2.02E-06 | 2.02E-06 | mr1804_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 1.66E-07 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 5.84E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 3.35E-06 | mr1862_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 1.06E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 2.09E-06 | mr1924_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 1.41E-08 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 1.11E-07 | mr1954_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | 9.39E-07 | 9.39E-07 | mr1967_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709984421 | NA | 1.50E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |