\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709837399:

Variant ID: vg0709837399 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9837399
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGACGATGATATTAGAGTAGTATCCGGTAGTTTAGACGTGGTGTCTAGATTACGGGATATCATTATTTGGGGTTATATGCTGCGGATGAGATGTGGGCC[G/T,A]
CTGATGGTGACAGCTCAGTACGGGTATTCCTCCGCGCGTGTATATAATACTACGTTAATTCCCTGGGGAGGGTACTCCTACGTATTTAGCCCCGGTTGTA

Reverse complement sequence

TACAACCGGGGCTAAATACGTAGGAGTACCCTCCCCAGGGAATTAACGTAGTATTATATACACGCGCGGAGGAATACCCGTACTGAGCTGTCACCATCAG[C/A,T]
GGCCCACATCTCATCCGCAGCATATAACCCCAAATAATGATATCCCGTAATCTAGACACCACGTCTAAACTACCGGATACTACTCTAATATCATCGTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 2.90% 0.95% 4.80% A: 1.52%
All Indica  2759 92.30% 3.00% 0.47% 4.13% A: 0.07%
All Japonica  1512 89.30% 0.00% 1.52% 5.29% A: 3.90%
Aus  269 75.80% 19.00% 1.12% 2.60% A: 1.49%
Indica I  595 90.60% 0.00% 0.67% 8.74% NA
Indica II  465 95.50% 0.20% 0.43% 3.66% A: 0.22%
Indica III  913 94.60% 5.00% 0.00% 0.33% NA
Indica Intermediate  786 89.10% 4.60% 0.89% 5.34% A: 0.13%
Temperate Japonica  767 91.70% 0.00% 1.04% 2.87% A: 4.43%
Tropical Japonica  504 95.40% 0.00% 0.99% 2.98% A: 0.60%
Japonica Intermediate  241 68.90% 0.00% 4.15% 17.84% A: 9.13%
VI/Aromatic  96 67.70% 0.00% 5.21% 20.83% A: 6.25%
Intermediate  90 90.00% 1.10% 1.11% 6.67% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709837399 G -> DEL LOC_Os07g16770.1 N frameshift_variant Average:51.17; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N
vg0709837399 G -> A LOC_Os07g16770.1 missense_variant ; p.Ala4Thr; MODERATE nonsynonymous_codon ; A4T Average:51.17; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 unknown unknown DELETERIOUS 0.00
vg0709837399 G -> T LOC_Os07g16770.1 missense_variant ; p.Ala4Ser; MODERATE nonsynonymous_codon ; A4S Average:51.17; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709837399 NA 4.83E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 5.08E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 7.89E-07 NA mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 4.81E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 5.72E-06 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 5.73E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 3.94E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 3.04E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 3.57E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 6.37E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 2.81E-07 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 4.71E-09 NA mr1117_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 1.33E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 1.33E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 1.47E-06 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 2.00E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 9.93E-08 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 6.84E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 2.42E-06 NA mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 4.21E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709837399 NA 2.47E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251