\
| Variant ID: vg0709749074 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9749074 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGTGAGAGGGTTGGGCAGAAACGTGGGTGAGCAAAAGGTTTGAATGATTTTAAGGATTATTTCTCTCTCCCACTTTAGTAATTCAATTATTTAATTTGTG[C/G]
GTAGAATAATTTAGTGTGGATTTTTCTGAAGGTAGACGAAGATACCTAGATTCCATTTTCTTTGGTTGCACTAAAAAATTATGGATAGATTACTCACAGA
TCTGTGAGTAATCTATCCATAATTTTTTAGTGCAACCAAAGAAAATGGAATCTAGGTATCTTCGTCTACCTTCAGAAAAATCCACACTAAATTATTCTAC[G/C]
CACAAATTAAATAATTGAATTACTAAAGTGGGAGAGAGAAATAATCCTTAAAATCATTCAAACCTTTTGCTCACCCACGTTTCTGCCCAACCCTCTCACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.30% | 33.10% | 15.00% | 6.62% | NA |
| All Indica | 2759 | 62.90% | 9.40% | 22.47% | 5.26% | NA |
| All Japonica | 1512 | 14.60% | 71.40% | 3.90% | 10.05% | NA |
| Aus | 269 | 31.60% | 61.70% | 4.83% | 1.86% | NA |
| Indica I | 595 | 56.00% | 23.50% | 11.43% | 9.08% | NA |
| Indica II | 465 | 47.50% | 5.40% | 38.92% | 8.17% | NA |
| Indica III | 913 | 76.10% | 1.00% | 22.23% | 0.66% | NA |
| Indica Intermediate | 786 | 61.80% | 10.80% | 21.37% | 5.98% | NA |
| Temperate Japonica | 767 | 14.70% | 71.70% | 6.91% | 6.65% | NA |
| Tropical Japonica | 504 | 5.20% | 83.10% | 0.20% | 11.51% | NA |
| Japonica Intermediate | 241 | 34.00% | 46.10% | 2.07% | 17.84% | NA |
| VI/Aromatic | 96 | 63.50% | 20.80% | 9.38% | 6.25% | NA |
| Intermediate | 90 | 42.20% | 43.30% | 8.89% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709749074 | C -> DEL | N | N | silent_mutation | Average:63.294; most accessible tissue: Callus, score: 86.787 | N | N | N | N |
| vg0709749074 | C -> G | LOC_Os07g16610.1 | upstream_gene_variant ; 448.0bp to feature; MODIFIER | silent_mutation | Average:63.294; most accessible tissue: Callus, score: 86.787 | N | N | N | N |
| vg0709749074 | C -> G | LOC_Os07g16620.1 | downstream_gene_variant ; 1277.0bp to feature; MODIFIER | silent_mutation | Average:63.294; most accessible tissue: Callus, score: 86.787 | N | N | N | N |
| vg0709749074 | C -> G | LOC_Os07g16610-LOC_Os07g16620 | intergenic_region ; MODIFIER | silent_mutation | Average:63.294; most accessible tissue: Callus, score: 86.787 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709749074 | NA | 8.47E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | 4.94E-06 | NA | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | 4.22E-06 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | 6.49E-07 | NA | mr1247 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | NA | 7.59E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | NA | 5.62E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | NA | 8.45E-18 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | NA | 1.33E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | NA | 3.76E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | NA | 8.13E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709749074 | NA | 2.96E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |