\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709749034:

Variant ID: vg0709749034 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9749034
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCTGCCAAGTGGGTCCAGGTCGTGGCAAACTAAGCTAGGGTGAGAGGGTTGGGCAGAAACGTGGGTGAGCAAAAGGTTTGAATGATTTTAAGGATTAT[T/A]
TCTCTCTCCCACTTTAGTAATTCAATTATTTAATTTGTGCGTAGAATAATTTAGTGTGGATTTTTCTGAAGGTAGACGAAGATACCTAGATTCCATTTTC

Reverse complement sequence

GAAAATGGAATCTAGGTATCTTCGTCTACCTTCAGAAAAATCCACACTAAATTATTCTACGCACAAATTAAATAATTGAATTACTAAAGTGGGAGAGAGA[A/T]
ATAATCCTTAAAATCATTCAAACCTTTTGCTCACCCACGTTTCTGCCCAACCCTCTCACCCTAGCTTAGTTTGCCACGACCTGGACCCACTTGGCAGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 44.00% 0.91% 5.97% NA
All Indica  2759 80.00% 14.60% 1.34% 4.02% NA
All Japonica  1512 1.80% 88.00% 0.13% 10.05% NA
Aus  269 13.40% 84.80% 0.00% 1.86% NA
Indica I  595 67.10% 23.50% 0.50% 8.91% NA
Indica II  465 90.10% 5.60% 0.65% 3.66% NA
Indica III  913 91.00% 6.00% 2.63% 0.33% NA
Indica Intermediate  786 71.00% 23.30% 0.89% 4.83% NA
Temperate Japonica  767 2.00% 91.40% 0.26% 6.39% NA
Tropical Japonica  504 0.80% 87.70% 0.00% 11.51% NA
Japonica Intermediate  241 3.30% 78.00% 0.00% 18.67% NA
VI/Aromatic  96 14.60% 72.90% 3.12% 9.38% NA
Intermediate  90 41.10% 52.20% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709749034 T -> DEL N N silent_mutation Average:71.814; most accessible tissue: Callus, score: 86.787 N N N N
vg0709749034 T -> A LOC_Os07g16610.1 upstream_gene_variant ; 408.0bp to feature; MODIFIER silent_mutation Average:71.814; most accessible tissue: Callus, score: 86.787 N N N N
vg0709749034 T -> A LOC_Os07g16620.1 downstream_gene_variant ; 1317.0bp to feature; MODIFIER silent_mutation Average:71.814; most accessible tissue: Callus, score: 86.787 N N N N
vg0709749034 T -> A LOC_Os07g16610-LOC_Os07g16620 intergenic_region ; MODIFIER silent_mutation Average:71.814; most accessible tissue: Callus, score: 86.787 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709749034 NA 9.65E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 2.77E-20 mr1131 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 1.66E-17 mr1270 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 2.40E-14 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 1.46E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 1.86E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 3.05E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 2.63E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 2.76E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 2.53E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 9.29E-30 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 1.04E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 3.62E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749034 NA 2.18E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251